Table 2

Characteristics of 94 polymorphic SSR markers developed in Vicia faba L. (F=forward primer, R=reverse primer, Size = size of cloned allele, Ta = annealing temperature)
Primer Repeat F (5’– 3’) R (5’– 3’) Size (bp) Ta(°C)
CAAS1 (AAAGGG)7 AGTCAGGGGGTCGATTTTTC TCTTGCGCAGTTTTGACATC 212 55
CAAS2 (GAA)9 TACAAAAGCTCTGGGGCCTA CCAATTCCTCTGGGCAACT 202 56
CAAS3 (AG)7 CTGGTGCGTAAGGTTGATGA CAAACCACCACCAATCACAG 132 53
CAAS4 (CA)11 ATTGCAAGTCCTGAGGCAAG ATAATGGCGCCACAAAGTGT 160 57
CAAS5 (ACA)15 TACATCAGTCCCGCAAATCA CCATGTAGCCGATTCCACTT 150 55
CAAS6 (A)10 TGCAAAGTAATTCCGAAACAA CGCACATGAATTGGGGTAAT 150 56
CAAS7 (A)10 GACCCAAGCCTTCACCACTA TGTGTGGGATCCATTTTGAA 200 59
CAAS8 (AAC)14 AATTTGTTCAGCATCTCGGG CTGGTTGGTTCCTGGTGAGT 150 56
CAAS9 (AAC)9 GTGATGCTTTGCCTGTGCTA ATGGACGTTTGTAGGTGGGA 200 56
CAAS10 (AAG)5 CTGTTCGTCATCATCATCGG CGTAAATCAACCCCAACACC 150 53
CAAS11 (ACA)10 TCCCGCTATTCTTGCTCTGT GCTCAAAAATGCTTGTCTTTCA 170 54
CAAS12 (TGT)9 GAGGAGGATCCCACAATGAA GCCAAAAGAGCCATGGTAGA 210 56
CAAS13 (CAA)11aaatcccaaaaactgcaaattgtatgccatcttaaaccatac(CAA)7 CAAAAATCCCAAAAACTGCAA TCGATTTTTCGACTTGGGTC 130 56
CAAS14 (AAC)6 CCGTAGATCTCAAAAACCATGA GGAGGAAGGAAGCTCGAATC 170 60
CAAS15 (AAC)8 AACCAACATCAATGGCATCA TCTTTTCCTTTTTCCTCTTCCA 140 60
CAAS16 (CA)7 TCAAATTTCCCTTTGCAAAAAT GACCAAGGTCAACCACCTTT 350 56
CAAS17 (CA)8 TCAAACACCTACACACCCACA TCTCGGTCAATCTCACATGC 250 56
CAAS18 (CA)9 ATGGGAGGGCAAATTTTAGG AGTGAGTGGAGCGCTTGTTT 350 56
CAAS19 (CAA)6 AACATTTTTCCAATCGAGGC TGTAGGCTTACGGCCAAAGA 200 56
CAAS20 (CAT)5 ACTGGAAAATCCCAATGCAC AGCAAACTTGCACCCAACAT 190 56
CAAS21 (CTT)8 GAATTTTCAAAACATGAGTCCCA CCGGATCTGAAAAGACTTGC 175 60
CAAS22 (G)10 TGATGAACAGAACTGCGCTC ATTGGAGAGAGGCGAAATCA 190 56
CAAS23 (GA)6 ACCGCATGCTAGGGAGTCTA TGGGTGACTCACTTTTGTGG 220 58
CAAS24 (GA)6gca(AG)6(TG)8 TCACTCACAAGCCACTAAGTCAA GATGCGACACTATCCCCACT 200 56
CAAS25 (GT)15 TCCATAATCAATTGGCTAAGCTC AAGACTAACTCTCGACTGTATTTAGGC 150 58
CAAS26 (GT)7 CGGCTTGGTTAACTGGATGT TCTTCCTTTTCTTCAATGCG 160 58
CAAS27 (TA)6 TTGGCATCATGCTCTAATCG CTTGAAGTCGTGCCAGATGA 280 60
CAAS28 (TC)8 CCATTGATGCAGGAAAGGAT CAGCTTTGACAGCTCCAACA 160 58
CAAS29 (TCA)5 TGCAAGTCAGTAGCCAAGACA CTCGTCTCTCCTCATTCCCA 180 58
CAAS30 (TG)10 GGTTTTTAGGTGATTTTCGCA GCGAAACCTCGTATGGTTGT 170 59
CAAS31 (TG)12 CAACGCGCTAGAGGAAGAAG CCACTGCCCTAGCACACTAA 160 56
CAAS32 (TG)7 TTTGGGGTACAACACTGGGT CCTCACTCCTCTATATAAACAACACTT 200 59
CAAS33 (TGA)5 GCAGTGATTCTGGCAGTGAA TGCAGCAACATTTCCATCAT 190 56
CAAS34 (TGT)5 TTTCTCGCAATTGTTCTCACA TTCGATGAAATCCATCTTCTGA 200 57
CAAS35 (TTG)8 AGGCAGAAGTTTGGAAGCAA TCTCACTTCGGCTTCAGGAT 180 56
CAAS36 (A)11 AGCACTAGAGTTCCAAGCCA TTTTTATCGTTTCTTGTCACGC 130 52
CAAS37 (A)11 CAACGCAAGAACACGTGAAT TAGAGGCCAATTCAAGCCAT 190 54
CAAS38 (AAC)5 CGCCTCAGAACCAAGTTCAT TGCTTTGTTTTGGTTTTGTGA 170 56
CAAS39 (AAG)5 CTGTTCGTCATCATCATCGG CGTAAATCAACCCCAACACC 170 54
CAAS40 (AAG)6 CCAAAGCCACTTCCAAACAT TTCAGCCGGGCTTCTTTC 110 54
CAAS41 (AC)10 GAAACCCACTTGGTCGTGTC TTCATTTGGGTAGGCTCCAA 190 56
CAAS42 (AC)10 CAAGTGTCGACGCAAGAGAT TGACTTTTTGACTGCTCCCA 250 56
CAAS43 (AC)7 GAGGAAGTGTGAAAGGTCGC TCATTTTAAAGTGGTGTATGTGTGT 170 54
CAAS44 (AC)7 ACACACACACGCACACACAC CATGAACCTTTGATAGTTTTCCA 150 56
CAAS45 (AGA)5 ATGGCTTTGACAAAAGGGAA CTCCTTCACCCGACAATGTT 180 57
CAAS46 (AGA)6 AGATCGCAGGCGTAGAAAGA TGCTTCAACCACAACACCAT 200 58
CAAS47 (C)11 CAAATTGGTTTGCATATCCG AGCCCTTCACATCCATTGAG 200 56
CAAS48 (CA)10 CCTCCTCCTTTAATTTGTGGC TGAATCGTGAATGCTCTCTGA 200 56
CAAS49 (CA)10 ACCTCCATAGCAGCAGCATT GGCCAATTCTTAACGTGCTT 140 56
CAAS50 (CA)10 CACTGGACCATTTTGCATTC ATGAGATCCGGAGCAGATGT 140 56
CAAS51 (CA)11 AAGCATTAAAACTCCCATAGCG ATGTGTGCGTGTGTCATGTG 140 52
CAAS52 (CA)12 CATTCCATGTTGCGTTTTTG GGATAAGAGGGTGGTGGTGA 200 56
CAAS53 (CA)13 GGCCCATTTGTTAAGGGTTT AATGAGATCTGGCCTGGATG 200 56
CAAS54 (CA)6 CCATTGGACCTCTTTGCATT CCAGAGTGGATGATGATCTGA 150 54
CAAS55 (CA)6 ACTCACATACACGCACACACA AATGCTCTCATCCCTTTTGC 150 56
CAAS56 (CA)6 CACATACACGCACACACACA AATGCTCTCATCCCTTTTGC 150 56
CAAS57 (CA)8 GCCCGAGACACTTTGGTTTA CCAGAATGGATGAGGACCTG 210 56
CAAS58 (CA)9 CTCCTGGTCCATGTATGAATGA TGTGTGTATGTGTATGCGTGC 150 54
CAAS59 (CAA)10 GGCCAACATAGGTGAGCATT GTGTTGTAGGCCTTTGGTCC 200 56
CAAS60 (CAA)8 ATGCAAAATGAAATGCGACA TGTAGTTGTCTGTTTAATGGTTGTTG 190 56
CAAS61 (G)11 AGAGGAAAAAGGCAAATGGC CCCTTCATCAATCACACCAA 130 54
CAAS62 (GA)14 AATGTTGGGACGGAGTTCAG TTGTTGATTCATTCATCCCTTG 130 56
CAAS63 (GA)15 CGCAGAGAAACACTCCATGA GAAGTTGAATGTCATTTGTGTCAA 100 56
CAAS64 (GA)6 AAAATATAATAAACAAAGCAAAAGTGC CAGGTTTGTGGTTTCACCCT 200 54
CAAS65 (GA)6 CGATATTCCTCGGTTTCCAA CATGGGTCGTCTTCTCCACT 200 54
CAAS66 (GA)6 CATCACTTTCCAGCCTGTCA ATTTTCTGCCTCCCCTTTGT 190 58
CAAS67 (GA)7 GGGTTTCAGAGAAAGGGGTC CGCAAGCGTATTGGGTATTT 130 56
CAAS68 (GA)8 ATGGAGGTTGCGATTTGAAG CATCATCTCCACACTTTTTCCA 130 54
CAAS69 (GT)10 ATTACAAATGTCGGTGCCGT AGCACAACGATAAGATGATATGC 170 54
CAAS70 (GT)8 TCGCGATAGAGGTTTTGGAA AACAACAACGATTCATCACAAGA 200 56
CAAS71 (GTT)15 CCATGTAGCCGATTCCACTT TTCGGCAACGTAGGAAAAAT 160 54
CAAS72 (T)10 TTTTCCAGTGTCAACCCATCT ACATGAGGCCAAAAACTGCT 170 54
CAAS73 (TG)13 TTGCACCTCTGTTGAAGACG TCACCAACACTCTAATCCTCAATC 190 54
CAAS74 (AC)6 CCCACCGTATTACACAAGGG GCGAGGAAGAAGATGACGTT 200 56
CAAS75 (AG)15 TCGATTGCACAATAAATGGTTT GAGGTCGACTCCCATTGAAA 180 54
CAAS76 (AG)6 GCCTGTTAATGAGAAGAACTGGA TTTCAAAATTTAGTTTCTCTCTGTCTC 200 56
CAAS77 (CA)21 TAGCAGCCAACAATCAGTGG GGTGATGTTGCTCATGTTCG 180 56
CAAS78 (CA)7 TCAAATTTCCCTTTGCAAAAAT TCGAACACAACTTCTTCATTTCTC 180 56
CAAS79 (CA)7 TCAAATTTCCCTTTGCAAAAAT CATGGAAAATCTTTTATTTTGTGTG 100 58
CAAS80 (CA)8 GTGTGAAAACTCACCCGGTC TGTGTGTAAGTGTGTGTATGTGTGTG 130 54
CAAS81 (GA)15 AACTTACAGGGGCCACACAC TGTGCATTATACTTTACGTATGTTCCT 100 52
CAAS82 (GA)17 TTTGCTTGACAATGGTGGAA ATTCAACAAGCAAGGGTTGG 120 52
CAAS83 (T)10 GATTTGCGTTTAGGGTTCCA GAACAAACTACGTTTTATTGTCCAGA 180 52
CAAS84 (TA)6 TGTCGACACCACAGCTATTTT TGTGGTTCGTTGTTTTGGTG 200 56
CAAS85 (TCA)6 TTGAAGTGAATAAGATGAAGAAGTGT GTTGCCTTTCCTTGCATGAT 130 56
CAAS86 (TG)10 TCGCGATAGAGGTTTTGGAA CACAAACAACAACGATTCATCA 200 56
CAAS87 (TG)14 CTCTACCATGGGCCATTTCT AGAGATAGAGAGAGAGACAGAGATGAA 90 54
CAAS88 (TG)18 TCCTACCGATCTCTCTCTCCC GTGGCATAACCGCGTAAGTT 130 56
CAAS89 (TG)18 TGTCTCGCCTTCAATCTTCC CTTGCTAAGTGAGACTGCTGCT 190 54
CAAS90 (TG)19 TCCATAGTCGATGAGGACCG TTGTCTCATTGTCTTTCTTTTCTTTC 100 54
CAAS91 (TG)6 ATCTTCGGCTTGGTTGATTG GAGGCGGCCACATTAGACT 200 56
CAAS92 (TG)9 CGAGATCTGGAGTGGATTTAGA TTTTCATATGCCACATGCTCA 170 56
CAAS93 (TTC)5 GGCATTGCTTACTTACCGGA CGACGTCGACATTAACATGC 200 56
CAAS94 (TTG)9 TCCTCAACACGTGATGCAAT TGTAGGACCAGGAAGGTCGT 180 56

Yang et al.

Yang et al. BMC Genomics 2012 13:602   doi:10.1186/1471-2164-13-602

Open Data