Table 1

PCR primers for amplification and identification of single nucleotide polymorphisms in UGDH
Amplicon number Amplicon content Forward primer sequence Reverse primer sequence Amplicon size (bp)
1 Exon 1 GAA TGA ATC CTC CGC CT TTCCTG TGG TGA TGT TCG 437
2 Exon 2 CTTTCCCTATACCTGTCACC ACTCGTCATCTCACTCCACT 508
3 Exon 3 GTTCAGTTGACCTGCTGCTC CTAGGTGCTCAAGTGTGCTC 443
4 Exon 4 GGG CTA CTG ATG ATG TT CTC TGT CTG GGT TCT TC 494
5 Exon 5 AGC AGA AAG TAT TCG TCG CAG CTT AGC AGC AGG TaG 450
6 Exon 6 ACC AAC CCA CCC ATT GCC T CGG ACA CGA CTG AGC TAC T 669
7 Exon 7 AGT TGA TTA GTT TCT TGC TAA TAA TTG AGT TCC TGG 744
8 Exon 8 TTT GGA GAA GTT GGC TAA GG TGC TAT GCT TCT GAA TGG C 707
9 Exon 9 CGT TCA TAT CCT CAC AAG A TGG GGA AAT CGT TAC AGT A 522
10 Exon 10 TTC AAC CAG ACC ATT CCA CT TGC GTT CAT AAT CCA GTT CC 339
11 Exon 11 TAA GGT GAA GTG ACG GAA GC GGA GCA ACT AAG CCT GTG TG 473
12 Exon 12 GGG AATGTA GAC TGA CTC GCT ACT CAT CCA ATC ACT 1801

Xu et al.

Xu et al. BMC Genomics 2012 13:590   doi:10.1186/1471-2164-13-590

Open Data