Table 4

Primer details
Name Gene Nucleotide position Sequence (5’-3’) Amplicon length (bp) Annealing temp. (°C)
LongF1 trnF_atp6/atp6 28-49 ACTGAAGATGCTGAGATGAGCC 7961 55
LongR2 8012-8033 ATGGTCAGTTTCAAGGGTTAGG
LongF2 atp6/atp6_trnF 8012-8033 CCTAACCCTTGAAACTGACCAT 9649 55
LongR1 28-49 GGCTCATCTCAGCATCTTCAGT
16SA-Lmod rrnL 1943-1962 CGCCTGTTTACCAAAAACAT 580 53
16SA-H 2542-2562 CCGGTCTGAACTCAGATCACG
COX1F cox1 6613-6631 GAAACATGAGCAAAAATCC 190 53
COX1R 6821-6802 AATGCTTCTCAGATAATGAA
ND6F nad6 13996-14015 AACATCCCACCTAAATAAAT 106 53
ND6R 14137-14122 TAGCTGTTGCTTCAAATCC
AMP1F trnF_rrnS 5-23 ACGTAGCTTAAGTAAAGCACAGC 294 58
AMP1R 322-347 ATCAACTTGAGTTTCTCGTATAACC
AMP2F cox2_trnK_atp6/cox3 7776-7800 TCTTCATCAATACTAGAAGCCTCA 912 61
AMP2R 8712-8731 TGTGCTTGGTGTGCCATTA

The names, gene and nucleotide positions, sequences, expected amplicon lengths and annealing temperatures of PCR primers used to generate the long-amplicons and to verify the specific identity of the long-amplicon and sequences of the primer regions.

Lloyd et al.

Lloyd et al. BMC Genomics 2012 13:496   doi:10.1186/1471-2164-13-496

Open Data