Table 1

Characteristics of 50 EST-SSR primers developed in L. luteus. Shown for each primer pair are the library specificity, repeat motif, forward and reverse sequence, allele range size (bp), number of alleles, amplification in other Lupin species, and annotation
Marker name Library Repeat motif Forward primer (5-3) Reverse primer (5-3) Size (bp) No of alleles Amplification Annotation
l1l2itg33000 L1 (ACA)7 CACGTCAGTCCTTGCACCTA GCACAGCAACAACAACACAA 129-132 2 L.hispanicus
l1l2itg51784 L1 (TA)8 CATCCTTCAAAAACCATTTCAA AATGTTGATGAACGCGTGTG 274-280 3
l1l2itg52347 L1 (AT)8 CTCATGTTTCTTGGGTGGAAA CAATCATGTCTAAACCGGGAA 209-215 4
l1l2itg50343 L1 (AT)10 ATATTAGCGGCCATGCTGTT TGTTCATGTTGGTTGCAAGA 235-239 3
l1l2itg20858 L1 (AAC)12 ACCCCACTTCTCCCAACTCT TCCATGAATGAAATGGGGTT 229-238 3 L.hispanicus Pollen-specific protein SF3
l1l2itg20038 L1 (TA)9 TTCAGAAACAAAGGGGTTGC TCCAGAAATTCTTCTACATCCCA 179-183 3
l1l2itg52625 L1 (TCA)12 CTGGTCTTCTGTCGACTCCA GACCAAGAAGTCAAGCTCGG 109-124 4
l1l2itg37631 L1 (CT)12 TAAAGTGCCACCAACAAGCA TTGTGTTGGTTGTGTGTAGAGAGA 133-155 6
l1l2itg27097 L1 (AAT)7 TTCAACTACCGGTTGAACCAC GCCCAGAATTAGGGTGCTTT 206-209 2
l1l2itg22424 L1 (GAA)7 AAACGACCAACCGCATAAAG GATGCGTGAAACTGCAAAGA 240-249 3 L.hispanicus N-acetylglutamate synthase
l1l2itg29703 L1 (GA)8 ACCTTTGCGCCAAGATACAC ATTGTGACGGTTTCACTCCC 213-219 4
l1l2itg28437 L1 (TA)9 GGGCACATTTGACTCTTTCG TCCGTGCAATGTCAATATCAA 260-268 4 L.hispanicus
l1l2itg36804 L1 (ATA)12 CACATGAGAAGCAGCAATGAA ATGCGGTGGAGTGGAAGTAA 254-260 2 L.hispanicus
l1l2itg21177 L1, L2 (CAT)8 CCTTGAGGCCAATAAATGGA TTAAGGAAGCTAGGGCCACA 217-226 3 L.hispanicus Delta-8 sphingolipid desaturase
l1l2itg39645 L1 (ATT)10 AATCATGGCCTTTTTGCTTG CGTCTTGCTCTGGTTCTTCC 148-169 5
l1l2itg35309 L1 (TA)8 TTCATGGCAAGAAAAACATCT AATCATCCATGCCATTTAACA 271-281 4
l1l2itg56943 L1 (GA)8 GAGGCCCAAAAACAGAAACA CCATTTGCGTTCGGTTCTAT 270-272 2 L.hispanicus, L.mutabilis
l1l2itg31693 L1 (TAT)8 AGGGGCAAAGCTCAAAGACT CATTCACATTTTATCCTCATTGACTC 196-217 4 L.hispanicus
l1l2itg10347 L1 (AT)8 TGTGGTAAATGCAGGCTCAG ATGCAACGGGAACCATAGTC 184-186 2 L.hispanicus
l1l2itg14618 L1 (CAT)7 TTCCTCATCTCCCACACCTC AGCTTCTGCTTGTAATCGGC 237-252 4
l1l2itg20466 L1, L2 (TA)9 GTAATCATTCATGTATAATTGTAACACTC CAATTCATTATCTGTATTATTACCCC 180-186 3 Cytochrome B561
l1l2itg53474 L1, L2 (GA)10 CTGAAGTGAGGTTCGGGAAG TCAATCACACATGCTTGTTCC 230-234 3 Cullin-1
l1l2itg51894 L1 (AT)10 TGACTTTGATTGTTTAGCTTACAGG TGAATGTCAAATGCAATATTAAGGA 247-263 3 L.hispanicus
l1l2itg24819 L1 (AT)8 CATTCATTCTCTAATCTTTTGTGTCA TAAAGCTTGTCTCTTGCCCG 219-244 5 L.hispanicus
l1l2itg55310 L1 (TA)9 ACCAAAAGGGTGGGTGAAAT CCTAACATTTGAACATATTTAAAACAA 277-283 4
l1l2itg14694 L1, L2 (TA)8 AAGTAGGAAGATCGAATATGAACG GGGAAAATATCGAGGTTTTCATC 268-278 3 L.hispanicus, L.mutabilis RNA-binding protein
l1l2itg35641 L1 (AT)8 AGTTGCAATTCAACAACGCA CATGCTCTATGGCAAGTGCT 247-251 3
l1l2itg38340 L1 (TAT)7 AGCTCCACTTTTAGAATTGCG TCTATTGTTACATGCACATTATCCC 164-173 4 L.hispanicus
l1l2itg26293 L2 (TCCGAA)15 CCTGCAGTGGTAGAACCTGG GAAGCAAGGTCCACAGAAGG 123-183 6 18S ribosomal RNA gene
l1l2itg42878 L2 (CATTCC)11 CAACTCTTGTTTGCAGACCG GCTACCCTTTCGGGACTAGC 217-235 4 L.hispanicus, L.mutabilis
l1l2itg13749 L2 (TTCCGC)8 TTTTTACTCGACTCGCTCCC CCAGTCGATTTAGCAGTCGC 207-261 7 L.hispanicus, L.mutabilis
l1l2itg32760 L1, L2 (CGGAAT)14 TCATAATGAATTAAATTAACCCCC TCCCTGACTCTGTCTTTGGG 146-284 14 L.hispanicus
l1l2itg00675 L2 (TCT)8(TCG)5 AGAGAGATCCTCTTTGACGCC GTGGTTAGCGAGAACCATCG 187-199 4 BSD domain-containing protein
l1l2itg45631 L2 (ATC)10 AAACCGAATTGTGGATCAGC GGGGACTCTGGAAAATCAGG 146-155 3 L.hispanicus, L.mutabilis Alphavirus core protein family
l1l2itg20349 L2 (AAC)7 ACTAAGGGAAAGGGATTCGG CCAGGCAAGAACAAAAGAGG 186-189 2 L.hispanicus, L.mutabilis LPA2 (low psii accumulation2)
l1l2itg41827 L2 (TTG)7 TTGAGTCATATCACCATAGCGG CAACCACAAATGGAAAACCC 242-245 2 L.hispanicus, L.mutabilis Lipase class 3 family protein
l1l2itg47916 L2 (TCT)9 GGTGGGTGAAAATGAAATGG TAACCAAAATGGTTCGTCGG 241-247 2 L.hispanicus, L.mutabilis
l1l2itg42002 L2 (AAC)8 CTTGCAGGGTCTTCTTACAGC GGGGTTGTTTTTGGTGTCC 243-246 2 L.hispanicus
l1l2itg54849 L2 (ACA)7 TTCTCCAATGATGAAATGCC TTCACGGCTAAATACCAAGC 177-183 2 L.hispanicus Microtubule-associated protein
l1l2itg13638 L2 (TGT)9 CCATGGTCATCATTAACCCC CGAGTCGAGTTCGTTTACCC 188-200 5 L.hispanicus, L.mutabilis f-box family protein
l1l2itg26640 L2 (AG)7 GGTCTGTTGGAGAAGGCTACC CCACCAATGGGTAGACATACG 203-209 3 L.hispanicus Small nuclear ribonucleoprotein
l1l2itg29887 L2 (GCT)10 CCCATCTGAAAGACTTACGGC TCCCTTTTCATCCAGAGAGG 243-249 2 L.hispanicus Ser/thr-protein kinase AFC2
l1l2itg50945 L2 (CCA)6(ACA)7 CCAGAACAAGGAGAAGGTTCC TTCTTCTTCCTCGCAGGC 198-204 3 L.hispanicus Zinc finger, Transcription factor
l1l2itg44905 L2 (CTT)9 AAATCACAGAGCCAAGGAGG TCAGCTTATTTTGTTTCCAAGC 356-362 3 L.hispanicus, L.mutabilis Transcription factor
l1l2itg09113 L2 (AT)8 CATGACCCAATCTCAAACCC GCATCTGGATCTGCTTAATTGG 341-343 2 L.hispanicus
l1l2itg03938 L2 (CCGATT)9 CATGTGGGAAGACCAGAAGC ACTACGCGCTGCTAATGTCC 212-290 7 L.hispanicus, L.mutabilis Polygalacturonase
l1l2itg32421 L2 (AATCGG)8 AGAGAAGTAGGCATGGTGGC GATCGGCCTATTCACTCAGC 221-293 5 L.hispanicus, L.mutabilis
l1l2itg29217 L1, L2 (AT)7 ACACTCTCAAGGAAAAGGGC CCATTTAACCGATAATGCTTGG 340-344 2 L.hispanicus Lactoylglutathione lyase
l1l2itg27515 L2 (TTC)17 CATGCGTCCAATCTATCACC AGTGGGAAACAAGGAAGTGG 182-221 8 L.hispanicus, L.mutabilis PPR-containing protein
l1l2itg41211 L2 (GAA)11 TCCTCCTGCTTCAGAACG AAATCCACGTCATCAATCCG 209-230 6 L.hispanicus, L.mutabilis

Parra-González et al.

Parra-González et al. BMC Genomics 2012 13:425   doi:10.1186/1471-2164-13-425

Open Data