Table 7

Primers used for RT-qPCR analyses
Transcript Primer sequence (5’-3’) Fragment Ta Efficiency Accession No. Source
Δ5fad GTGAATGGGGATCCATAGCA 192 bp 56°C 0,945 AF478472 1 [9]
AAACGAACGGACAACCAGA
Δ6fad_a CCCCAGACGTTTGTGTCAG 181 bp 56°C 0,928 AY458652 1 [9]
CCTGGATTGTTGCTTTGGAT
elovl2 CGGGTACAAAATGTGCTGGT 145 bp 60°C 0,926 TC91192 2 [24]
TCTGTTTGCCGATAGCCATT
ipi ACAGCCCTATGGTTATGTGTCATCTC 230 bp 60°C 0,985 CK875291 1 [11]
CAAGGTGAGGCGAATGTTTGAAC
mev CCCTTAATCAGGGTCCCAAT 247 bp 60°C 0,910 DW005667 1 [11]
GGTGCTGGTTGATGTCAATG
7dchr CTTCTGGAATGAGGCATGGT 230 bp 60°C 0,977 TC99602 2 [11]
ACAGGTCCTTCTGGTGGTTG
srebp2 GACAGGCACAACACAAGGTG 215 bp 60°C 0,887 DY733476 1 [11]
CAGCAGGGGTAAGGGTAGGT
lrp1 ACCAACCGCATCTACTGGAC 204 bp 60°C 0,996 CK898816 1 New design
CAGATTACCAGCCACCCAGT
apoA4a CCCAAACCAACACCACTCCT 150 bp 60°C 0,997 BT047465 1 New design
GGTTTATATTTCTCACCCTGCAC
apoA4b CTCTTGCCCTCTTGATGACTG 154 bp 60°C 0,918 BT047267 1 New design
TGACTCATCAGAGCCAATTCA
lpl AGGGCGTTAATCCATGTCAG 223 bp 60°C 0,917 TC84899 2 [8]
GACCTTTCAAAAGGGCATGA
lpp2 TCCGGAAGAACTCGCAATAC 174 bp 60°C 0,926 NM_001140716 1 [9]
ACATCACGTCCACCAAGACA
mgat TTAACCCAAAGATGCTGCAA 157 bp 60°C 0,977 EG824440 1 New design
CACGCAGTTGTCAGTGGTTT
alox5 TATCTCCCTCTCCCTCAGTCC 155 bp 56°C 0,987 CX727592 1 [57]
GGTCAGCAGTGCCATCA
pla2g4 GTCGCTGGCTGGAGCTGTGG 138 bp 60°C 0,998 NM_001141333 1 New design
AGCCCTATGGGCCCTGGTCA
thas TGTTCACACGGACCTGATTC 150 bp 60°C 0,986 NM_001165312 1 New design
GACCGGATCGTCATTCTGTT
ptgis GCGTGTTTGTGGTCATTACG 247 bp 60°C 0,836 GE778709 1 New design
TTCCCTTAGCAAGGTCTGGA
mal GGCCTCAGTCAAAGAGGAGA 156 bp 60°C 0,946 NM_001141320 1 New design
GGGGAGTGCACACTTTAGGA
ccl13 CGAGGATCCCTCTTCAACAA 178 bp 60°C 0,996 EG831431 1 New design
ATCGTCGACTAGGCAGCAGT
trim25 GCAGGGTCCTATCTCATCCA 215 bp 60°C 0,951 BT048046 1 New design
GGACTGGACCTTTTTATTCTCTCA
lect2 CTGTGTTGTCAGAGTGCGAGATGGT 150 bp 60°C 0,996 BT050009 1 [58]
TACACACAATGTCCAGGCCCTGA
cfh TGTGATGATGGAGAGATGCAG 193 bp 60°C 0,966 TC141997 2 New design
CAAGCGACAAAGAAACCACA
Reference genes*
elf-1α CTGCCCCTCCAGGACGTTTACAA 175 bp 60°C 1.000 AF321836 1 [11]
CACCGGGCATAGCCGATTCC
β-actin ACATCAAGGAGAAGCTGTGC 141 bp 56°C 0.939 AF012125 1 [11]
GACAACGGAACCTCTCGTTA

1 GenBank (http://www.ncbi.nlm.nih.gov/ webcite).

2 Atlantic salmon Gene Index (http://compbio.dfci.harvard.edu/tgi/ webcite).

* geNorm average stability (M value) of reference genes = 0.514 [59].

Morais et al.

Morais et al. BMC Genomics 2012 13:410   doi:10.1186/1471-2164-13-410

Open Data