Table 5

Primers used in this study
Primer Sequence (5’- 3’)
ccpAmut1 ATAATATCTAGAACCAAGTATACGTTTTCATC
Accout ATAATAATAGGTACCGCTTCGAGTCCGGAATC
KmkfwR ATAATAATATGTACAGATAAACCCAGCGAACCA
KmkbwR AATAATAATAATAGTATACTATAAAACATCAGAGTATGGA
tetPccpAfw ATAATAATATGTACAGCATGGTCCTAATTTTTGTT
tetPccpAbw TACTGGATACACTTATCCTTCTGCAGGCATGCAAGCTA

Marciniak et al.

Marciniak et al. BMC Genomics 2012 13:401   doi:10.1186/1471-2164-13-401

Open Data