Table 1

Genes analyzed by quantitative real-time PCR
Gene Primer sequence Size (bp) Accession number (GenBank)
Upregulated genes/sequences APP F: ACCCCTGACGCCGTTGAC 121 NM_001076796.1
R: TCATGACCTGGGACATCCTCTC
AQP4 F: GTTCACGGAAATCTTAGCGCT 104 NM_181003.2
R: TCAGTCCGTTTGGAATCACAG
CPPED1 F: TTGGATGGCATCACCGACTT 101 NM_001031771.2
R: TTTGCGACCTCATGAACCAC
GOLGA4 F: TCTACCAAAACCACTGCCTCAA 88 NM_001192125.1
R: TCCCACTACTGGCTCTACATCACT
MPP7 F: GCCTCCTATGCCTGATGACAT 81 NM_001100347.1
R: CCCAGTGGTTCTCTATTTTTGACC
NELL2 F: AAGAGGGAGACGATGGACTGAG 105 NM_001102084.1
R: ACACCAAGACCCCAAACTGCT
OSRS1* F: GAGGATCTTGTGGAACCATTGA 124 FQ482089.2
R: TACGGACAGCTGAACCCTTTC
OSRS2** F: TTGTCAGTCCCCATCACCTTT 101 NW_003104406.1
R: CATTGATTTGCACAGAAAACCA
Downregulated genes CD3G F: AGCTTCAGACAAGCAGACGCT 101 BC103010.1
R: GGGTTCAGTTCTTCCTCAGGTG
GNLY F: TCCGTGCCAGTCAATCATGA 101 NM_001075143.1
R: TGCAGACCTTGATGTCCACAC
LAPTM4B F: GGTACTTGATCCTCAATGCCG 101 NM_205802.1
R: AAAGTCACCCCCGAGTTCAGA
SRSF3 F: CGAAATGCATCGTGATTCCT 101 NM_001034700.1
R: AATAGCCAAAAGCTCGTTCCA

Primers (F: forward and R: reverse) used for gene amplification, amplicon size and GenBank accession numbers of the bovine cDNA sequences used for primer design.

*Ovine Scrapie Related Sequence 1 (OSRS1) has a high identity (92%) with the Bos taurus DNA sequence from clone CH240-103 G5(accession number: FQ482089.2) from 4172 to 4904 bp.

**Ovine Scrapie Related Sequence 2 (OSRS2) has a high identity (93%) with the Bos taurus chromosome 15 genomic scaffold, Bos_taurus_UMD_3.1, whole genome shotgun sequence (accession number: NW_003104406.1) from 2672152 to 2672419 bp.

Filali et al.

Filali et al. BMC Genomics 2012 13:399   doi:10.1186/1471-2164-13-399

Open Data