Table 7

Primers used for real time PCR for expression analysis, Acc is accession number from NCBI
Gene name Primer name Primer sequence(5-prime to 3-prime) Acc Product size Ann T Tissue
Fabp2 FatF GCTCTGTACTAGCTCTCCTCCC CB509140 156 bp 55 °C Mid intestine
FatR GGCGTACAGTTTGACTATGCAC
Caspase-14 Cas14F CGATTATACACCCGGACTATGG S35582566 155p 55 °C Mid intestine
Cas14R CCTATCAAGTGTGAATCCATGC
TCR alpha TCRaF GGAAGACTCTGCTCTGTACCAC U50991 147 bp 55 °C Mid intestine
TCRaR GCTGTGGTATTTCTTGACTTC
IgM heavy chain IgMF GCTTATAGCCATAGTACTACTG S18892409 169 bp 55 °C Mid intestine
IgMR GCATAGCTGCCCCATATCGC
Tpm1 Trop1F CGAAGATGAGAGAGATAAAGTGC TC76471 134 bp 55 °C Mid intestine
Trop1R CCTCCTCAACCAGCTGGATACG
RFC3 ReplF GCTGACTCACTGCATTCCTCCTG S34421775 163 bp 55 °C Mid intestine
ReplR GAAGGCCTCTAGGTGGTAAATGG
HTRA1 HTRA1F GGTCATCTTCATACAGAGAGG S35582821 152 bp 55 °C Liver
HTRA1R GCTTAGAGAATACCATCTTGC
TGF beta receptor TGBF CCACAAGAAGCCAGCTGTCAG gi|209735249 135 bp 55 °C Liver
TGFBR CTAGCCAGGTATCTCTATCATGG
MRPS18A 28 S F CCATTGATTCAGTGAAGCCCATC DW574268 158 bp 55 °C Liver
28 S R CCTGCTGTGAGTTGACATGC
Timd2 TcellF CCATGGACAACCACACACACTG CA368982 141 bp 55 °C Liver
TcellR CCAGTAGAATGGACACCAGGATC
Hepcidin I HepF GCTTCTGCTGCAAATTCTGAGG gi|209736931 157 bp 55 °C Liver
HepR GTACAAGATTGAGGTTGTGCAG
TCR alpha TCRaF GGAAGACTCTGCTCTGTACCAC U50991 147 bp 55 °C Liver
TCRaR GCTGTGGTATTTCTTGACTTC
CDIP CellF CCATGTCTGAGACCTACTCTATG TC110067 243 bp 55 °C Skeletal muscle
CellR GATAGTCACTTGATGTCCAGTG
acta1 protein ActaF CCTGTAAACTGTGAATGCGTC TC77227 156 bp 55 °C Skeletal muscle
ActaR CCAAAGTTTTATATCAGCTGC
TGF beta 1 TGF1bF GCTCGGAGTGTGAGACAGAACTG S15319964 187 bp 55 °C Skeletal muscle
TGF1bR CACTTGACGCAACAGAAACACTCC
RT1-CE5 MHC1bF GGAAAGATCTCCTGAAGACTTGAG CK894557 101 bp 55 °C Skeletal muscle
MHC1bR CGTTTATGAGAAGTTCAGC
60 S rib prot 60SF GCTTCTTACCATGGTTCTTCAG DR695852 140 bp 55 °C Skeletal muscle
60SR GGTCAAGATCCCATCCACCATC
Heat shock protein 30 HeatF CCATCCAACCAGTCTCCTACAAGC EG804126 303 bp 55 °C Skeletal muscle
HeatR CCTCCTCAGCAGATAATGGATTC
Hprt HprtF CCGCCTCAAGAGCTACTGTAAT EG866745 255 bp 55 °C All tissues
HprtR GTCTGGAACCTCAAACCCTATG

Tacchi et al.

Tacchi et al. BMC Genomics 2012 13:363   doi:10.1186/1471-2164-13-363

Open Data