Table 3

Example of a potential miRNA sequence alteration
hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
Sample Sequencing Reads Counts (≤1 Bases Different) Counts (0 Bases Different)
LEIO_1 ACUGGACUU - GGGUCAGAAGGC 10 0
LEIO_2 ACUGGACUU - GGGUCAGAAGGC 15 0
LIPO_1 ACUGGACUU - GGGUCAGAAGGC 25 0
LIPO_2 ACUGGACUU - GGGUCAGAAGGC 15 0

The reference mature sequence of miR-422a is shown along with RNA-sequencing reads for each duplicate of one leiomyosarcoma (LEIO) and one liposarcoma (LIPO). The column denoted by " ≤ 1 bases different" reports the number of sequencing reads when allowing for a single base difference in mapping to the reference. The column denoted by "0 bases different" reports sequencing reads when allowing for no differences in mapping to the reference.

Fountzilas et al.

Fountzilas et al. BMC Genomics 2012 13:332   doi:10.1186/1471-2164-13-332

Open Data