Table 2

RAD sequence reads of the 38 SNP candidate markers linked to anthracnose disease resistance gene Lanr1 in cultivar Tanjil of Lupinus angustifolius discovered by RAD sequencing on NGS platform Solexa HiSeq2000
Candidate markers* Coverage depth** DNA sequences (5’-3’)***
Candidate marker 1 7.0/6.4 AATTCAGATTCAAGCGTGAAATATTTATACGTAGGAGAAAATGAGAGAAGGGAGGTCTGTGAGAGAAAGAGTA[G/A]AAAGAAAAAAATAAAAAA
Candidate marker 2 5.7/6.7 AATTCAACACACCGCTCATCTCA[A/C]CTACTTTCAAAATCAACCGTCTATGGATTATCTCCACTAAGATAATATATATTATAATAAAAAATGAA
Candidate marker 3 7.1/7.5 AATTCCACAAATTGAAAAACCCGACCGCTTTTTTCATGAAATGCCAATGAAAATG[T/C]TGTTAGTACTAATACTAATTAATTGACTTCTATAAG
Candidate marker 4 11.9/13.9 AATTCCACCAGGATTGCACAACACTAATCTCAACTTGGTCTTGTTGTTTTTCATAATTGGCATCTACACCAATTG[C/G]ATATCAACACTGCTTT
Candidate marker 5 7.2/7.7 AATTCTTCTTCAGAAACAAGGAGCCAATC[G/C]GATTCCAAATGCACTGAAGGAAGCTCAAGCAGAAAGCAAAATCTAAAGAGATTAATCTGATA
Candidate marker 6 9.0/8.8 AATTCTTACAATGAACTTCTATTTTCATTTTGCACTACTAAATCATATTTGCAATATATATGTGTTATATTATGCAAACTGAATCTTT[A/G]TAT
Candidate marker 7 13.7/13.3 AATTCATCTGTACTGATTTCTTTCATATCAAATAGCAGCAGTGGCAATCCTAAAAATAGAATGACCTCT[C/T]GATGTGTGTGCATTATGTGTAT
Candidate marker 8 8.7/9.1 AATTCTTTAAACTTTTGTTCCTTTATTTGAAGTTCTCTTGCTTTTTCTAAATCAAGTAAATTAGGAGTC[A/C]TAACAAAGTTTACCTTAGAGCA
Candidate marker 9 9.1/8.8 AATTCAGAGACAGGACTCATGGCTTATTGGTAATTGGAACATT[C/T]GGAAATAGCAATGAAATCAAAGAAATTCTAGATAACCAAAAAAACACT
Candidate marker 10 15.4/15.8 AATTCTTAAAACAAATTTATACAAGTTTCTCTTTTATTCATTCATGAGAATAAGTCAAAATTGAAAATGGAAGGTAACCC[A/T]TATCAAAGCGT
Candidate marker 11 4.2/10.9 AATTCTATATCTTAGTGATTC[C/A]GTGTAACTTATACTACTAGAGGTAGGTGTGGGATGGCAATTTGACTAGTGAAATGAAGTAAAGTGACTGC
Candidate marker 12 6.8/8.5 AATTCGAACTCATATATGAATACGTGGGCATTCTTTATCAATTGAGTTAGTTGATTATT[A/T]TTTTAATTTCTTAAAAAGTTTTGAGAGCACTT
Candidate marker 13 10.9/11.4 AATTCTGATGTGAAACAACGTGAAAAGAAAGGAGAAAAATCTGTCTTCTGAACAAGAAATGGACA[G/A]ATATCAAAGCTCAGCCAGGAGCATTT
Candidate marker 14 7.42/9.24 AATTCTCTCACAAGCTAATCGACATTCATCTGTATGCTTTGC[T/A]ACAGTAGACTCTAGGACTTTCTCAAGTTCAGTCACTCTATTGCTTAGCT
Candidate marker 15 12.8/14.2 AATTCTCATAATATTTTATAGATCTCATTTAAGAGTTTAAATAGTTAG[G/C]ATAAAGTTTTTTACACATTATTATGATTAGTATTAGTATGTAT
Candidate marker 16 12.0/11.6 AATTCCCCTCAAATTAACACTGTTTCTCGTTTGGGTTCAAGAGCCCTTTGCTTATTGCTTTGAGTTTAAA[G/C]CTCCAAACTTTAAATAGAGTT
Candidate marker 17 14.9/15.6 AATTCCAGAGGATACACATGACACACTACAACATTAGTACCCG[A/G]CAATGCCTCAAAACTGCGGTCTAATATGAAAAAATCGATGTCTTTGTT
Candidate marker 18 13.3/12.5 AATTCACACTCAATCATGTTCTGCAGCTTAAACT[A/G]AAAAAACAATAGGACCTTTTGCTCTTGATAAAATTTCTGATTTAAAAAATGTACAAG
Candidate marker 19 18.9/19.2 AATTCATTCAAGGGTCTTGTCAATCAATTGA[A/C]AAAGATATATGATGAGTTGCAAGCACTTATGCTACTAAGTTCGTTGCTTGAAAACTGGGA
Candidate marker 20 12.9/13.6 AATTCTAGTTTTGTCTTGGTCCTATTGTTTGCTTGATTTTTCAATTCATTACTAAACTATT[C/T]TGACAGTTACTGCATACTATTTGCCTTAAA
Candidate marker 21 16.2/19.2 AATTCTGAAGCAAGTGTATACATTTAAGTTCTAGAAATAGAAAGGATACACTCACGG[G/A]ATGAGATAGCCAAGATAAACTATACATGGAATAT
Candidate marker 22 28.9/26.1 AATTCTAGTTTCTTTTATCTTGTTCTTTTCCCAGAAGATATTACTTGTCTTTAATTTTCTTTTGGGTGGGA[A/G]TGGGAGTGAGGGGAATTAAA
Candidate marker 23 18.7/19.8 AATTCTTTTGTTGATAACCTCAAACAAGATGGCCTAGTGTTAATCATTGGTTAGAACA[C/G]TGAAATTAATTTTTGTTTTTAAGACAACATATA
Candidate marker 24 20.2/19.8 AATTC[T/C]TAATAGGTGTAGTAGGATATATAATAAGAATACTTAAATTACTTAAAAAAGTACATAGATAGATAAATATCACTATTCGACACTCT
Candidate marker 25 14.4/16.6 AATTCTCCGTCTCTCCCCCTTCACCTTGCGGAGCAAAATCCCTCAATAGGTCCCAAGTTGACGAATCATTATCCA[C/T]CGCCGAAATCCTAATT
Candidate marker 26 7.9/7.1 AATTCTCAAGTTAAATATGATGTGGCTAACAGGGTTCACTTCTAGGTCTCGAGGTT[G/A]CTGATGCTGAAAGATCTTATCATACTGAATTGATC
Candidate marker 27 25.1/27.5 AATTCCAAATCTTTAGCTGAAAAGTCAATTAACAACTATCAACATTTTATTCAGTAGAAGTG[C/T]ATAACAGACTAGATATTGGTATTAATAAT
Candidate marker 28 21.4/20.2 AATTCATAACTACTTTGTAATTGATCAAGCTTTTCTTGCTGATCATCATTCTCTTTT[C/T]TCTCTGATTCTCTATGTTGAGTATCAAGAAATAA
Candidate marker 29 14.3/16.0 AATTCAAGCTGCTATCAACTTT[A/G]AAGCTCTCTCCCCACATGCTAACTTGATCAAATGGCTCATATATGCCCATCTTTTTCCCAATGACTAGT
Candidate marker 30 8.9/11.0 AATTCAACAACAAAAAATCATCGTAACGCCAG[T/C]AATCCTCATTGCAACAACTATAATGGCCGCAACCATAATTTAAAATACCGATTTTGTTT
Candidate marker 31 20.5/21.1 AATTCATATTCCACACAGATTTGTTCAACTGTTGAATTTGCTTACATGTCCTGAATCAAAAAGAAGAGAAAAGTTTAGACAC[G/T]ATGCGGTCA
Candidate marker 32 18.4/17.0 AATTCGAAATGGAGAGCAATGTCACTTTCATAAATGGGATAAACAAAATTTCGTTACTTAGTGCAACAGTTGGAATGCC[T/G]GTAATAACAAGC
Candidate marker 33 31.7/31.2 AATTCTGGTGCTGCGACAGAAGTGTTATGCA[A/G]AACTATTAGTCATCCTCTTAAGGTAAAACCTATTATGCTGTTACAAAAGTTCAGCTTGCC
Candidate marker 34 21.9/17.4 AATTCATTACCCTTGACA[A/C]CCTACATGAATTAGTAAAAATAAGTTTAGCCAATTCTAACATGGAACCTGTAGCATATAAAACCAATGTTCTA
Candidate marker 35 27.2/26.1 AATTCAAGCAAATTGGACCATGTGAAATCTGGATACTGTTTTGTCCCATCTTTGACAACAATAGCCTCTGG[T/G]GCTCTCAACACTTTGTCTTC
Candidate marker 36 26.5/28.8 AATTCTGCTAGTGAAGCTGG[A/G]GTTTTTCCTGCACCTGCACATTTTAGACTAGTGCCACATGAACCTGTTTGGCAATTGCCATTGCCACTTTT
Candidate marker 37 25.8/24.8 AATTCTTAGATACTTACAAGGAACAAAATAATTCGGTATATGGTATAAGACCAACACCAACTCAACATTGCACG[G/A]CTACACTAACAGTGATT
Candidate marker 38 32.2/27.6 AATTCAGTGGAATATTTCATGTTCACAAACACATTCGACCATAGCGAGAAAGTGCACCTCTC[T/A]TATTCTATTCATACCTGAATGGTTCTAAG

*Candidate marker numbers were consistent to the candidate makers listed in Table 1.

**The first number was the average coverage depth (x) of the nucleotide from the 10 plants susceptible to anthracnose disease; the second number was the average coverage depth of the nucleotide from the 10 plants resistant to anthracnose.

***The first nucleotide of each SNP in bracket for each RAD sequence read was from parental plant Unicrop; the second nucleotide of the SNP in bracket for each RAD sequence read was from parental plant Tanjil.

Yang et al.

Yang et al. BMC Genomics 2012 13:318   doi:10.1186/1471-2164-13-318

Open Data