Table 2

Polymorphic SSRs primer pairs derived from N. nervosa unigenes
ID name Locus Repeat motif ORF Forward and Reverse Primers Amplicon length observed BLASTX, seq description Seq Lenght (bp) Sim mean (%) GO terms related to response to stress
isotig00192 INTANOT1 (tct)5 Y F: CCAGATGGGTTTTTGCTTGT 148 heat shock protein 81-1 2309 97.2 response to stimulus
R: GACGATGAAGACGATGAGC
isotig00230 INTANOT2 (tcg)5 N F: TTTCCAAACGGTTCCAGAAG 120 af367280_1at3g56860 t8m16_190 1229 76.6 response to stress
R:AACGGAGAAGGATGTTTCCA
isotig00551 INTANOT3 (tcattt)3 Y F: CCGATGTGATCGATAGGCTT 204 ac005850_9highly simlilar to mlo proteins 1759 77.5 defense response to fungus
R: CATGTCCCCAGTTCACCTCT
isotig00597 INTANOT4 (ta)6 N F:AAAACACCACCAAACCCAAA 197 dnaj heat shock n-terminal domain-containing protein 1516 78.3 response to stimulus
R: CTTTGCCACGGCAACTAAAT
isotig01207 INTANOT5 (tct)7 N F: CTCGAAGACGCTACCAGACC 280 af214107_1 -like protein 748 79.3 response to stimulus
R: TCCTGGGTTTTGCATATTGG
isotig01232 INTANOT6 (atc)4 Y F: CGTTTCCCTTTAGCTGATGC 173 aldh6b2 3-chloroallyl aldehyde dehydrogenase methylmalonate-semialdehyde dehydrogenase oxidoreductase 741 96.8 response to stress
R:GCTGAGTTAGCAATGGAGGC
GR7D2IN01BK031 INTANOT7 (ag)5 N F: GACGACATCGTTCCGAGTTT 241 f-box family protein 536 75.4 response to heat
R: GTTAATCCCTCTCTCCTCAT
GR7D2IN01CGQUT INTANOT8 (ccgaaa)3 Y F: CTCCCTCAAACACCTCCAAA 236 mitogen-activated protein kinase kinase 518 90.5 response to osmotic stress
R: ATTCAAGTGGGTCTTGCCTG
GR7D2IN01EMGE0 INTANOT9 (ct)8 N F: CCGGCTACCTGTTTGTTTTA 155 at1g78870 f9k20_8 507 100.0 response to metal ion
R: TTCCTTGATGATTCTTCGGG
GR7D2IN02FPPC7 INTANOT10 (ggt)6 Y F: AAAATTGCTGTTGAGGGTGG 117 af361609_1at1g27760 t22c5_5 529 87.9 response to osmotic stress
R: CCTGAATCACCAGACCGAC
GR7D2IN02GFAUT INTANOT11 (gaa)4 Y F: ATCCCCAATCTTTCCCAATC 115 salt overly sensitive 1 315 78.5 response to reactive oxygen species; response to osmotic stress
R: AATTCTGTCCGCTTTGGCTA
GR7D2IN02GR6NZ INTANOT12 (at)5 Y F: TCTTGTGGCAAGTGCTTGAG 285 win2_soltu ame: full = wound-induced protein win2 flags: precursor 472 94.0 defense response
R: ACTATCCTCACCGTTGCCTG
GR7D2IN02HOKOI INTANOT13 (tc)5 Y F: ATATCCTGGAAATGCTTGCG 124 exec1_arath ame: full = protein executer chloroplastic flags: precursor 469 71.7 response to reactive oxygen species
R: TAAACGATCTTCGGAATGGC
GR7D2IN02HWXOR INTANOT14 (tgg)8 Y F: AGGAGCTAAATGGGCGTAA 260 glycine-rich rna-binding protein 452 86.5 response to stress
R: CACCACCACCACCAAAGAA

Included are ID names, primer names, motive and number of repeats, position in ORF, sequence of forward and reverse primers (5′3′), amplicon length (bp), BLASTX similarity matches (Putative Function), Sequence length, Similarity Mean (%), GO terms related to stress response.

Torales et al.

Torales et al. BMC Genomics 2012 13:291   doi:10.1186/1471-2164-13-291

Open Data