Table 1

Primer pairs used for real-time quantitative reverse transcription PCR analysis of expression patterns ofPhakopsora pachyrhiziESTs
Clone/contig Target gene product Primer sequences Amplicon size (bp) Primer (nM) Annealing temperature (°C)
Pp30041 serine/threonine-protein kinase Forward GGAACCAACGTCGACAAGAG 130 200 60
Reverse CTGGTCCTCCTCAACCTCAG
Pp32431 prefoldin subunit 5 Forward AACCTGATCAACTGGCATCC 81 200 59
Reverse CCTTTAGTTGCCCAAACGAG
Pp32821 ubiquitin-protein ligase Forward AAATTCCTGGAGACGATTGC 150 300 60
Reverse TTGCACTACCTTGTGCGGTA
Pp34951 G2/M phase checkpoint control protein Sum2 Forward CAGCCTAGAACAGGTCAGATCC 105 200 58
Reverse GCCCGGAAAACGATAAATTC
Pp35051 hypothetical protein Forward GAGACAAGCCCCATTGAGAG 104 200 60
Reverse GTCTTTGGCAGGGTCTTCTG
Pp36841 HMG-CoA reductase Forward CGACAGCTTGCTCGAATTATC 87 200 60
Reverse CTTAACCAAGTGTCCAGCTGC
contig2F1 5-aminolevulinate synthase Forward GATGAGGTTCACGCCATTG 117 200 60
Reverse GTCCACCCGATCCATTACAC
Pp31861 hypothetical protein Forward AAGGACTGGTGAGGTTGGTG 76 200 62
Reverse TGCTCTACCACCGTAGGACC
contig2N1 P-type cation-transporting ATPase Forward GCCTGAAGTGATTCCTCAGC 124 400 55
Reverse ATCCCAACAAACGAAAGTG
Pp30422 GTPase-binding protein Forward TGCCCAGAAAATTGGTTCTC 102 300 58
Reverse GCCAAAAGTGCATACCGAGT
Pp32052 NADPH oxidase A Forward ACCCAAGGCTGCCATTAGTA 134 300 56
Reverse GGTGCCCTCCATAAAACAAA
Pp32222 septin/cell division control/GTP binding protein Forward TCCTCCCAAAGAACATCCAG 135 300 60
Reverse AAGTCTCCATAGCCCGGAGT
Pp34092 MFS sugar transporter Forward CGGATGTAGCATGGAGACTAATG 123 300 60
Reverse CATCTGAAATCCACCCCTTAGA
Pp37172 tripeptidyl-peptidase 1 precursor Forward GGCGGAGGGTTTTCAAATTA 116 300 59
Reverse CTTCCTGACCCATCGAACAT
Pp38882 microtubule associated protein Forward GGGATCAGCTCTACGTCTGC 150 300 60
Reverse AGATTGCCAGCAGCCTTTTA
Pp39442 autophagy-related protein 8 Forward CCGTATTCCTGTCATCTGTGAG 107 300 60
Reverse CATAGACGAACTGCCCAACC
Pp39982 delta (12) fatty acid desaturase Forward CCCTCTCCTCCCTCACTACC 135 300 59
Reverse TTGGAGCACAGATGATGAGC
Pp40002 subtilase-type proteinase psp3 Forward TCACTTTGACATTGGAACGAG 93 300 60
Reverse GCAACCTCAGGAAGGGTTCT
contig2S2 acyl-CoA dehydrogenase Forward AATCGATACCGCCGTCTATG 124 300 60
Reverse CCTGTGTAAGCCGAAGAAGG
contig6B2 conidiation-related protein Forward AATGACAGAGGTGGCGAGAC 107 300 60
Reverse TGTCGAAGCTCGTCCTTTTT
Pp4812 MAS3 protein Forward CGTGATGGTACTCGAACGAAC 68 200 62
Reverse CTTGAAACCTCACGGTCTCG
NA3 P. pachyrhizi Forward CCAAGGCTTCTTCGTGTTTCA 65 200 60
α-tubulin Reverse CAAGAGAAGAGCGCCAAACC

1Primer pairs used for quantification of mRNA transcripts throughout the infection cycle.

2Primer pairs used for quantification of mRNA transcripts during germination, germ tube elongation, and appressoria formation.

3Primer pairs used for both quantitative analyses.

Stone et al.

Stone et al. BMC Genomics 2012 13:269   doi:10.1186/1471-2164-13-269

Open Data