Table 10

Sequencing primer information
Primer Name Primer location Primer sequence (5’- 3’) Tm Amplicon size (bp)
Seq1_F 112776-112797 GGACATCTCCAAGTTTGCAGAG 66 760
Seq1_R 113535-113512 GAAACATTTGACATCAGAGTCAC 64
Seq2_F 113459-113479 GTCAAGGAGAGAGCTTTGTGG 64 729
Seq2_R 114187-114165 TGGACAACACATTACACATTCTG 64
Seq3_F 114050-114071 GGCTTCTAGACATCCAACATAG 64 756
Seq3_R 114805-114784 GATAGCAGTGCTGCCACAACTG 68

Primer locations (chromsome 7) are based on NCBI reference sequence NG_016465.1. “F” –forward primer; “R”- Reverse primer.

Han et al.

Han et al. BMC Genomics 2012 13:217   doi:10.1186/1471-2164-13-217

Open Data