Table 2

Characteristics of 158 SSR markers in this study
Locus
    GenBank
Repeat motif Primer sequence (5'-3') Size range(bp)a Na Ho He PIC PHW
Accession
ZJU001ab JQ318696 (GA)10 F:<NED > <Tail-1 > CCTCTCCACCCATGAGAAAC 160-188 7 0.1667 0.4271 0.4002 0.0000
R:CAAATCATTCCCTGCTTTCC
ZJU002ac JQ318697 (TC)13 F:<NED > <Tail-1 > TCAAAGAGACGTTGTGGCAG 219-229 4 0.2083 0.5257 0.4572 0.0005
R:TCCGCTCACAGACAGAGAGA
ZJU003ab JQ318698 (AG)11 F:<NED > <Tail-1 > GTCACCTTGCTCTTCTTGGC 203-217 8 0.7407 0.8344 0.7949 0.0003
R:TCCTTGTACTTGTTCTGCTGGA
ZJU004ac JQ318699 (GA)10 F:<NED > <Tail-1 > AACAGAACCATCGTCAAGGC 204-210 4 0.3571 0.7325 0.6704 0.0003
R:GGTACAGTCGCTCCGGTTTA
ZJU005ab JQ318700 (AG)14 F:<NED > <Tail-1 > CTTTGGACATGGCAACACAC 200-228 11 0.3000 0.8679 0.8291 0.0000
R:TCCACTTTGACAGATTCCCA
ZJU006ab JQ318701 (GA)10 F:<NED > <Tail-1 > CTCGCCCTCTCTCTCTACCA 193-205 5 0.2593 0.3305 0.3089 0.0000
R:AGTTTATCCACCCGTGTCGT
ZJU007ab JQ318702 (AG)13 F:<NED > <Tail-1 > TGATCCATTGGAACCATGTG 193-209 8 0.5625 0.6617 0.6302
    0.1868
R:TCAGTTGATGGTGCAGAAGC
ZJU008ab JQ318703 (CT)10 F:<NED > <Tail-1 > GGAGAAATGAACGGTGGAGA 191-215 10 0.7931 0.7973 0.7563 0.0002
R:TCCAAAGCTAATACCCACGC
ZJU009ab JQ318704 (CT)10 F:<NED > <Tail-1 > AATTGTCGCAAGTAGTCGCC 207-221 5 0.0741 0.3599 0.3371 0.0000
R:ATATCAACCCATGGGAGCAA
ZJU010ab JQ318705 (CT)11 F:<NED > <Tail-1 > TGCAACATCGAAATTGGAAA 181-205 9 0.9032 0.8012 0.7614 0.0000
R:ATGCCGGCAAGTCTTAGTGT
ZJU011a JQ318706 (GA)10 F:<NED > <Tail-1 > GGAGGCTCGTCAGTCATCTC 200-216 9 0.2692 0.7926 0.7554 0.0000
R:TTAGCGTCCCTTCTCTCTCG
ZJU012ab JQ318707 (CT)12 F:<NED > <Tail-1 > CTTCACTCACCGCCTTTCTC 184-218 13 0.5000 0.8571 0.8251 0.0000
R:AATGGCCTCCACATCTCAAG
ZJU013ab JQ318708 (CT)10 F:<NED > <Tail-1 > ACTTGTCATTCCCACGTTCC 211-221 6 0.4444 0.5199 0.4515 0.0094
R:CACTCCATCTCAACCACCCT
ZJU014ab JQ318709 (AG)15 F:<NED > <Tail-1 > TGGAATGTCGATCTGAAACAA 186-212 13 0.6875 0.9033 0.8791 0.0251
R:ACCAGCTTATACGACGGTGG
ZJU015ab JQ318710 (GA)11 F:<NED > <Tail-1 > TTGGTGTGGTGGTAATGGTG 199-221 6 0.6154 0.6614 0.5902
    0.0585
R:AAATAATGCAAGCAGGTGGG
ZJU016ab JQ318711 (TC)10 F:<NED > <Tail-1 > CCGTTGACTATTGCCCAGTT 196-216 11 0.6333 0.8469 0.8130 0.0179
R:GGCAATTTCCAAATCGCTAA
ZJU017ab JQ318712 (CT)13 F:<NED > <Tail-1 > ACTGAAGAACCAAACGTGGG 180-200 6 0.6250 0.7093 0.6518 0.0003
R:GGTGTGTTTCTCTGTGTGCG
ZJU018ab JQ318713 (CT)15 F:<NED > <Tail-1 > ACGAAATTTGACCAATCGCT 196-216 7 0.1429 0.7189 0.6667 0.0000
R:AGGGTTTCTTCTGGTTCGGT
ZJU019ab JQ318714 (GA)12 F:<NED > <Tail-1 > TTTCATAACCCGTTGGCTTC 209-219 6 0.2800 0.6865 0.6317 0.0000
R:AAGGTGGAAACGTGTCAAGG
ZJU020b JQ318715 (AG)10 F:<NED > <Tail-1 > CACAGGACATGTGATGGAGG 201-213 7 0.5172 0.7453 0.6983 0.0000
R:CCATCCTGAGCTTTGTCGAT
ZJU021a JQ318716 (TG)10 F:<NED > <Tail-1 > TCGCCAGCTTCCTAATGTCT 190-212 8 0.7778 0.7428 0.7025
    0.0663
R:GAGCGCATGTTGTTGCTAAA
ZJU022ab JQ318717 (GA)10 F:<NED > <Tail-1 > AAGCTTAAGCAAGCGTCGAG 188-208 9 0.6923 0.8575 0.8227 0.0109
R:TGCGAAGGGAAATTTCAGAC
ZJU023ac JQ318718 (AG)15 F:<NED > <Tail-1 > GTGTTTGGGCAGCACCTATT 200-226 14 0.6667 0.8840 0.8544 0.0251
R:AAAGAGTACAACAACGCGGG
ZJU024ab JQ318719 (TC)10 F:<NED > <Tail-1 > CCGCATGTTTGATTGATGTC 180-196 6 0.6000 0.7345 0.6716
    0.1624
R:GCGTTGAGCGGAGAGATTAC
ZJU025ab JQ318720 (TC)10 F:<NED > <Tail-1 > TTTGAGCGATAGTACGGAGG 216-234 8 0.2667 0.7537 0.7044 0.0000
R:ATATGCTACGTTGGTTGCCC
ZJU026ab JQ318721 (TC)10 F:<NED > <Tail-1 > CCAGACAGGTTAGCCACCAT 200-220 10 0.4545 0.8573 0.8199 0.0000
R:GCCTCTGGATCTCGATTACG
ZJU027 JQ318722 (TTC)8 F:<NED > <Tail-1 > GTTGCAATTTGCCTCCATTT 203-227 6 0.3125 0.6250 0.5321 0.0003
R:GGTGCCTATACTGCCAGCTC
ZJU028ab JQ318723 (AG)10 F:<NED > <Tail-1 > CAACCATCCAAACCAAATCC 164-170 4 0.1724 0.2789 0.2566 0.0000
R:TCTACCAATCGTGGCTAGGG
ZJU029ab JQ318724 (AG)10 F:<NED > <Tail-1 > TCTTCCGGGATGTCTACAGG 189-205 6 0.5312 0.6925 0.6296 0.0480
R:CAACAGCAATCGCAAAGAAA
ZJU030ab JQ318725 (CA)13 F:<NED > <Tail-1 > AAGTGAGCTCTCCCTCCCTC 193-205 7 0.4286 0.7208 0.6676 0.0000
R:CACCGAAATACTTGCCGTTT
ZJU031ab JQ318726 (GA)16 F:<NED > <Tail-1 > GCACAGGAACACCAGGATCT 179-195 8 0.8387 0.7948 0.7492 0.0000
R:CCAAGCCCTAATTCCCTTTC
ZJU032ab JQ318727 (TC)11 F:<NED > <Tail-1 > ATTCCCACGTTCGTTCAGAC 204-226 8 0.6786 0.6442 0.5852 0.0220
R:GATGCCTAACTCCGAATCCA
ZJU033ab JQ318728 (TC)10 F:<NED > <Tail-1 > GCACAAGTTGCTGACATGCT 195-207 6 0.0690 0.6655 0.5897 0.0000
R:AGTTGCATTCAACCCACACA
ZJU034ab JQ318729 (CT)10 F:<NED > <Tail-1 > ATGGGAATGTGGAGAACGAG 191-209 8 0.4138 0.7762 0.7250 0.0000
R:GCTTTGCTTCTTTGCTTTGG
ZJU035ab JQ318730 (GA)14 F:<NED > <Tail-1 > TTGGATCCTGGTTACCTTCG 201-217 8 0.1290 0.7425 0.6900 0.0000
R:AAACTGCATGCATGGTTCCT
ZJU036ab JQ318731 (GA)10 F:<NED > <Tail-1 > CTGCCACTCTTACTGGCCTC 186-214 8 0.3333 0.5895 0.5516 0.0000
R:ATGTGCCCAATCTTGACTCC
ZJU037ab JQ318732 (TC)10 F:<NED > <Tail-1 > GTGATTTCCCTCCCATTGAC 208-228 9 0.8125 0.7867 0.7429 0.0135
R:ACGAAGCGGGAAGTAGGATT
ZJU038b JQ318733 (AG)10 F:<NED > <Tail-1 > CTTATGGCCCGTTTGTAACC 194-200 4 0.2273 0.5106 0.4646 0.0007
R:AACGATTGCTTTAAGCGGAA
ZJU039a JQ318734 (CT)10 F:<NED > <Tail-1 > AAACGAAAGTGGGCGTATTG 219-229 6 0.3077 0.6161 0.5745 0.0004
R:CACCAGTGCGTCCTATGAGA
ZJU040 JQ318735 (TC)16 F:<NED > <Tail-1 > AAACTCCGTGCTGGAATCAA 198-220 10 0.3182 0.8192 0.7798 0.0000
R:GCAGACAAGCCTTCCTGTTC
ZJU041ab JQ318736 (TC)11 F:<PET > <Tail-2 > TGATCACCTTTCAGTTGGCA 226-244 5 0.2258 0.3199 0.3031 0.0000
R:CACATTGGCAGAGTCCTGAA
ZJU042ab JQ318737 (TC)10 F:<PET > <Tail-2 > AGGATTTCTCCAGAGGGACG 220-242 5 0.3571 0.5331 0.4880 0.0000
R:GGTTCCGCATCAAACTACAAA
ZJU043b JQ318738 (CT)10 F:<PET > <Tail-2 > AAACCGAGCTCTCCTAAGCC 225-245 4 0.5714 0.6383 0.5667
    0.2655
R:CTCGCAATTTCTCGGGATAC
ZJU044ab JQ318739 (GA)12 F:<PET > <Tail-2 > GATGGTGGCTTGTCTTGGTT 235-255 8 0.2500 0.5091 0.4853 0.0000
R:AAGTGGGACGTCAATTCCTG
ZJU045ab JQ318740 (CT)10 F:<PET > <Tail-2 > GAGAGAGGGAGAGAGGCCAT 228-258 13 0.6129 0.8821 0.8544 0.0007
R:GGAAGATTCATGGGAGAGGG
ZJU046ab JQ318741 (AG)10 F:<PET > <Tail-2 > TTGCTGTAAGCATCGCAATC 226-242 7 0.3871 0.6256 0.5824 0.0000
R:AAGCTCCGGTAACACACACC
ZJU047ab JQ318742 (GA)13 F:<PET > <Tail-2 > TTCGATCATTCATGAGGCTG 247-259 7 0.7097 0.7615 0.7074 0.0019
R:TTAATTGCATCCCGGATTTC
ZJU048ab JQ318743 (CT)14 F:<PET > <Tail-2 > AGCGGACCGAGTTGTAGAGA 230-254 12 0.2903 0.8493 0.8166 0.0000
R:CCAACCCTACAAAGCGAGAG
ZJU049ab JQ318744 (GAA)8 F:<PET > <Tail-2 > GTGTCTGCAGCAACTTCCAC 234-267 10 0.8125 0.7262 0.6797 0.0000
R:GTCGGAACCGAAGATGGTTA
ZJU050ab JQ318745 (AG)11 F:<PET > <Tail-2 > GTCACAGCCTGGATAGCTCC 233-245 7 0.3000 0.7288 0.6916 0.0000
R:GTCTCTCCTGGATGAGCTGC
ZJU051ab JQ318746 (AG)12 F:<PET > <Tail-2 > AGAGAAAGACCGGGACCAAT 229-233 3 0.4333 0.4198 0.3594 0.0012
R:GAGAAATAAAGCCGAGCGTG
ZJU052ab JQ318747 (AG)16 F:<PET > <Tail-2 > CCCGAGCTGAACGAAATAGA 230-248 9 0.4348 0.8628 0.8261 0.0000
R:GGATCAAAGCGTTGTCGTTT
ZJU053ab JQ318748 (AG)10 F:<PET > <Tail-2 > AAATCCGAAACACCTCTCCC 222-240 8 0.5000 0.5655 0.5211 0.0001
R:ATGTGGAGACTTCCACTGGG
ZJU054ab JQ318749 (CT)13 F:<PET > <Tail-2 > TTGATTTGCTTTGTGCATTTG 232-250 9 0.3000 0.8667 0.8268 0.0003
R:CAAACTACCGTGCCCAACAT
ZJU055ab JQ318750 (CT)10 F:<PET > <Tail-2 > TTATGGGTTTCATTGGGCAG 238-254 6 0.2500 0.7006 0.6357 0.0000
R:TCACCAGGCTACTGCATGTC
ZJU056ab JQ318751 (GA)13 F:<PET > <Tail-2 > GACAAAGTGGGTGCCATTCT 230-246 7 0.5714 0.7643 0.7122 0.0068
R:TGCATGCTTCCTTTCTTCCT
ZJU057ab JQ318752 (CT)10 F:<PET > <Tail-2 > TCATGTGGAGATTGAAGCCA 230-244 6 0.1579 0.6814 0.6283 0.0000
R:CGTCCCGAATGAAGATTTGT
ZJU058ab JQ318753 (GT)10 F:<PET > <Tail-2 > TCCGGAGCTTTCAATCTCAT 252-274 11 0.7500 0.8274 0.7900
    0.8036
R:GCCTACGAACTCAGGTTCCA
ZJU059b JQ318754 (TC)14 F:<PET > <Tail-2 > TGTTTGTTTCTTGCTATTTCCATC 217-235 7 0.5200 0.7935 0.7505 0.0016
R:GACAGTTCCCACCAGCATTT
ZJU060ab JQ318755 (GT)8(GA)9 F:<PET > <Tail-2 > TGGCCAGGAACTTTGTATCC 223-243 7 0.6562 0.8110 0.7691 0.0000
R:GAAAGATTGGGAATGCTGGA
ZJU061ab JQ318756 (TC)11 F:<PET > <Tail-2 > TTTGGAGGAAGCAAACAAGC 204-232 11 0.2812 0.7922 0.7506 0.0000
R:TCCTGCGCCAACAATCTAAT
ZJU062 JQ318757 (TC)10 F:<PET > <Tail-2 > GTCGAGAGAACAAAGCGACC 240-252 7 0.2400 0.3282 0.3135 0.0004
R:GTCCAATGCCGCACTAACTT
ZJU063ab JQ318758 (TC)12 F:<PET > <Tail-2 > ACTCAGCAGGACCACCAACT 232-250 10 0.7000 0.8593 0.8270
    0.1320
R:TTAGACGGAAATTGGGCTTG
ZJU064b JQ318759 (GA)10 F:<PET > <Tail-2 > ACCATGAAGCTGACCTGGAG 226-244 6 0.4348 0.7256 0.6666 0.0001
R:TTTCGTGGTCCCACCTACTC
ZJU065ac JQ318760 (CA)13 F:<PET > <Tail-2 > TCCAGAATATCATCTCTTGCCA 214-236 9 0.6333 0.7706 0.7219 0.0001
R: ATATTCCTAACGTGTGCGGG
ZJU066ab JQ318761 (GA)10 F:<PET > <Tail-2 > CTTTCCCTTGTCGCTTTCAG 221-235 8 0.2593 0.6450 0.6075 0.0000
R:GGTCGCAGATCAGGTCAAGT
ZJU067ab JQ318762 (CT)10 F:<PET > <Tail-2 > CAGACAGCGAGGAGACAACA 217-263 11 0.6923 0.8273 0.7861 0.0070
R:GGTCTTTCGAACTTTGCTCG
ZJU068ab JQ318763 (CT)10 F:<PET > <Tail-2 > GAAGCTAAACGCCAGAAACG 227-239 6 0.2917 0.7535 0.6913 0.0000
R:ACTCCTCACACGAATGGGTC
ZJU069bc JQ318764 (GA)10 F:<PET > <Tail-2 > TGCCATAATCCTGAGAGCCT 224-258 8 0.2609 0.5594 0.5235 0.0004
R:TGTTCTGTAATGGCGTGGAA
ZJU070ab JQ318765 (CT)11 F:<PET > <Tail-2 > GTGCTCGAGATGTCCTCCAT 221-247 7 0.5200 0.7861 0.7364 0.0000
R:ACAATCCCATCGCATACAGG
ZJU071ab JQ318766 (GA)10 F:<PET > <Tail-2 > CTAAGGTTGGTCCCTGTCCA 228-234 3 0.3704 0.6157 0.5305 0.0110
R:CTTGTGTGGTGATGGTTTGG
ZJU072ab JQ318767 (AG)10 F:<PET > <Tail-2 > AGTCAGCGTGGGAATGTACC 223-237 7 0.5625 0.7604 0.7117 0.0000
R:TTTCAGAACAAGTTCGTCGC
ZJU073a JQ318768 (AG)12 F:<PET > <Tail-2 > TACGCCAAGATCCAAAGACC 222-242 7 0.2105 0.7568 0.7087 0.0000
R:TCTCGAGTTGAGTTTGGGCT
ZJU074ab JQ318769 (CT)15 F:<PET > <Tail-2 > TGCAGAGGAACTGGTGACTG 215-239 10 0.5517 0.8234 0.7831 0.0007
R:GAGAAGGCTCAGTGGGTGAG
ZJU075b JQ318770 (CT)17 F:<PET > <Tail-2 > AATAAACACACAGGGCGAGG 239-255 9 0.0769 0.8650 0.8307 0.0000
R:ATCGGGCAGACCAGAATATG
ZJU076ab JQ318771 (AG)9 F:<FAM > <Tail-3 > ATGGTTACCGACGTCCTCTG 131-169 11 0.8438 0.8353 0.8034 0.0000
R:AGTGCAGAGTGCGAGATCAA
ZJU077ab JQ318772 (AC)9 F:<FAM > <Tail-3 > TTTGGAATTCAACAACATTTAGAC 137-153 8 0.2000 0.6590 0.6079 0.0000
R:TGCAGCCTTGCTCCTCTTAT
ZJU078ab JQ318773 (TC)10 F:<FAM > <Tail-3 > ACACCACGGTTCTTCGATTC 130-146 6 0.5500 0.7513 0.6881
    0.1339
R:GTAACGAGGCTCTTGCTTGC
ZJU079ab JQ318774 (TC)13 F:<FAM > <Tail-3 > AAGGCTAGACCGCAATCTGA 116-134 9 0.8438 0.8596 0.8291 0.0008
R:GGGCAACAGTTTACTTCCCA
ZJU080ab JQ318775 (CT)9 F:<FAM > <Tail-3 > CTTGACGAAATGCAGACGAA 124-134 5 0.2903 0.3411 0.3172 0.0103
R:TCCGGATCAGGGTCAAATAG
ZJU081ab JQ318776 (GA)8 F:<FAM > <Tail-3 > TGCTCTTGCAGAGAGTCGAG 137-157 6 0.5517 0.5820 0.5379 0.0003
R:TCATAATACCCTTGGCAAACA
ZJU082ab JQ318777 (CT)10 F:<FAM > <Tail-3 > TATATCGAATCCCAAAGGCG 129-141 5 0.3438 0.4043 0.3792 0.0169
R:AAGATATTGGTCCGGCTCCT
ZJU083ab JQ318778 (AG)10 F:<FAM > <Tail-3 > TAGCCTTGGAGATTTAGGGC 133-157 11 0.8667 0.8960 0.8692 0.0000
R:TTGAAATTTCGCAGCCTCTT
ZJU084ab JQ318779 (AG)9 F:<FAM > <Tail-3 > TTTCGATTGGTGGTCTGTGA 124-138 6 0.1379 0.5197 0.4766 0.0000
R:TTATTAACTTCACTTTGTTTATTCGG
ZJU085ab JQ318780 (AG)9 F:<FAM > <Tail-3 > GCTTTAACCGAGTGATGGGA 150-184 8 0.6875 0.5992 0.5383
    0.6352
R:TAAAGGAGCGCTGGAAAGAA
ZJU086ab JQ318781 (TC)10 F:<FAM > <Tail-3 > TCCTCTCTTTCACACTTCCGA 118-152 13 0.9062 0.8720 0.8445 0.0005
R:GGTCGATCATTTCTCTCCCA
ZJU087ab JQ318782 (GA)9 F:<FAM > <Tail-3 > CGAGTGTAGCTAGGAACGGC 135-149 8 0.4688 0.7748 0.7273 0.0204
R:AATTGGACCTGCAAATCTCG
ZJU088ab JQ318783 (CT)9 F:<FAM > <Tail-3 > GAGCTCCGAACTTCTTCCCT 126-150 13 0.9677 0.8773 0.8490 0.0053
R:CTTCTCCACAGGACTCTGCC
ZJU089ab JQ318784 (GA)8 F:<FAM > <Tail-3 > CGTTAGGATTCGGGAACAGA 138-152 7 0.8065 0.7382 0.6778 0.0000
R:CAGGGCTAATGTGGACCAGT
ZJU090ab JQ318785 (AG)9 F:<FAM > <Tail-3 > GGAAATCTCCGAATGTGATCC 118-134 8 0.2903 0.6642 0.6089 0.0000
R:TGGTGGATGAACCACTCAAA
ZJU091bc JQ318786 (TC)15 F:<FAM > <Tail-3 > AAAGAGCACACAGCCCTAGC 124-146 10 0.4615 0.8695 0.8358 0.0012
R:GGCAGTGTCGCAGTGATAGA
ZJU092ab JQ318787 (TG)10 F:<FAM > <Tail-3 > CTCTTGCCGACCTCATTGTT 127-151 11 0.6875 0.8264 0.7916 0.0041
R:CGGGACTCGCATAAATCACT
ZJU093ab JQ318788 (GA)10 F:<FAM > <Tail-3 > ATGCCATGTTGCATGAGTGT 130-156 12 0.9355 0.8662 0.8367
    0.3689
R:TATCCCGTAAGCAATCAGGG
ZJU094ab JQ318789 (CT)10 F:<FAM > <Tail-3 > ATCACGGGTTCTGCTGTTCT 124-150 10 0.9062 0.8646 0.8332 0.0000
R:CAGAAGAAGCCATTTCTGCC
ZJU095ab JQ318790 (AG)9 F:<FAM > <Tail-3 > TACCCACCGTACCAAAGGTC 114-130 7 0.4839 0.7070 0.6420 0.0004
R:GAATGAACCCAGGCGATAGA
ZJU096ab JQ318791 (CT)10 F:<FAM > <Tail-3 > CATACTGCAATGCATCTCCC 126-154 13 0.8000 0.8757 0.8479 0.0310
R:TCAATTTGTGTGCCCTTACG
ZJU097ab JQ318792 (AG)10 F:<FAM > <Tail-3 > AATTGTTAGGGAGGGCTCGT 118-134 8 0.8438 0.7778 0.7297 0.0009
R:TGCGTTGTGGAGACCATTTA
ZJU098ab JQ318793 (CT)9 F:<FAM > <Tail-3 > GACGCTCCATCTCTGGTCTC 145-167 10 0.9355 0.8831 0.8549 0.0483
R:CCCAAACCGCACTAGAGAAA
ZJU099ab JQ318794 (GA)10 F:<FAM > <Tail-3 > TTGTTGCACTTGTGGGTGAT 130-150 9 0.7742 0.7763 0.7299 0.0000
R:AACTACAAACAGCCCAACCG
ZJU100ab JQ318795 (TC)9 F:<FAM > <Tail-3 > ACTTGTCCGGATTCCACAAC 128-154 5 0.8333 0.6316 0.5629
    0.2930
R:TCAAGGCACACAATAATGCAA
ZJU101ab JQ318796 (AG)9 F:<FAM > <Tail-3 > TGATTGAGCTGCCAACAAAG 134-154 7 0.6667 0.7062 0.6527
    0.8110
R:TTTAACATTTGGCACCGACA
ZJU102ab JQ318797 (GA)10 F:<FAM > <Tail-3 > GAACCACGAACTTCAACCGT 118-132 8 0.4231 0.5890 0.5441 0.0111
R:AACCACCAAACTTAGCTTCCA
ZJU103ab JQ318798 (AG)9 F:<FAM > <Tail-3 > TGAGGAGGGAGTTGAGTTGG 121-139 10 0.7097 0.7731 0.7359 0.0003
R:GCGTCTTCCTCCTCCTTCTT
ZJU104ab JQ318799 (TA)9 F:<FAM > <Tail-3 > ACGTGGCAGTTGAGTTGTTG 114-128 6 0.3704 0.6296 0.5702
    0.1383
R:TCAGATCTCCGTTGGAGCTT
ZJU105ab JQ318800 (GA)11 F:<FAM > <Tail-3 > TGAGAAACGCAGCAAGAGAA 135-157 11 0.5806 0.8165 0.7801 0.0000
R:CATCTCTCCCAAGCATCCTC
ZJU106ab JQ318801 (GA)8 F:<FAM > <Tail-3 > GCAGTCGGATAGAGAGACGG 134-146 7 0.3636 0.7717 0.7203 0.0000
R:TGTTGATCAAACACACCGAGA
ZJU107ab JQ318802 (TC)10 F:<FAM > <Tail-3 > TGGTGTCACGATTCACTGGT 114-130 8 0.4375 0.5322 0.5012
    0.3632
R:CTGCATGTAATGGCAGTTCAA
ZJU108b JQ318803 (CT)9 F:<FAM > <Tail-3 > TTGGTAGTGCACTGCAGGAG 132-160 13 0.3929 0.8253 0.7909 0.0000
R:CGAGGGTCGAGTTCAGAGAG
ZJU109ab JQ318804 (TC)10 F:<FAM > <Tail-3 > TCCGCTCTCCTCTCTGTCTC 138-164 11 0.8000 0.8441 0.8082 0.0003
R:GTGAGTTGTGCTGCTGCAAT
ZJU110ab JQ318805 (AG)9 F:<FAM > <Tail-3 > TTGCACGGTGGTAGCTGTAG 143-159 5 0.7667 0.6486 0.5844 0.0000
R:ACTGTGGTCCGTCGAACTCT
ZJU111ab JQ318806 (TC)8 F:<FAM > <Tail-3 > TTTCTAATGTTGTTCGCCCA 122-136 5 0.9000 0.5701 0.4652 0.0000
R:TCATTCTCCTTGCAGATCCC
ZJU112ac JQ318807 (GA)8 F:<FAM > <Tail-3 > GGAGAGTGAGAGATCGCAGC 133-147 8 0.4839 0.6557 0.6212 0.0009
R:GGCAACACCCTCAGTATCGT
ZJU113ab JQ318808 (AG)9 F:<FAM > <Tail-3 > AAACGCACCAGAGAAAGACG 138-154 6 0.6667 0.6588 0.5987 0.0130
R:TCCATCTCTGGTCTCCATCC
ZJU114a JQ318809 (GA)10 F:<FAM > <Tail-3 > CTAGAGCGCTCCACGATACC 132-160 12 0.8214 0.8740 0.8448 0.0388
R:AGAACGCTTGGAGAATCGAA
ZJU115ab JQ318810 (AG)14 F:<FAM > <Tail-3 > GGTCTGAGGCCTTCACTCTG 126-156 14 0.9677 0.9022 0.8775 0.0068
R:GAGACCCAATAACCCATCCA
ZJU116ab JQ318811 (AG)15 F:<FAM > <Tail-3 > CTTTCTCCGTCTGCTCCATC 110-136 13 0.6875 0.8199 0.7846 0.0001
R:GTCCAAACTTGGAGCCCATA
ZJU117ab JQ318812 (AAG)9 F:<FAM > <Tail-3 > TCTCAGATCCCTCCACGTTC 118-133 6 0.4688 0.6944 0.6426 0.0000
R:CCACTGGATCAGGACAACCT
ZJU118ab JQ318813 (CT)9 F:<FAM > <Tail-3 > CAAGCCACGTGCATACCTATT 120-144 11 0.8750 0.8502 0.8171 0.0001
R:CAGCTGGCTTCTAACTGCAA
ZJU119a JQ318814 (AG)11 F:<FAM > <Tail-3 > CTTTCGACTTCAGAGGCAGC 136-152 9 0.4828 0.8348 0.7975 0.0000
R:TCCCTCTCAAACTTTGCCAC
ZJU120ab JQ318815 (GA)8 F:<HEX > <Tail-4 > TTGGTTTCGTTTGCAAGTCA 164-180 6 0.9355 0.7012 0.6354 0.0073
R:GTCATCCATCCAATCCATCC
ZJU121a JQ318816 (CT)11 F:<HEX > <Tail-4 > AATCACCGAAGAAATCCACG 164-186 11 0.8621 0.8705 0.8426 0.0000
R:ATTGCCCTCCCTTCTGTTCT
ZJU122ab JQ318817 (TC)8 F:<HEX > <Tail-4 > TGACGGAAGGATACTGGCTC 164-180 7 0.7742 0.7509 0.7012 0.0000
R:CCATCAGACATGGCTTTCCT
ZJU123ab JQ318818 (CT)8 F:<HEX > <Tail-4 > TGAATTATTCGGTTCCCTGG 172-176 3 0.4667 0.6367 0.5499
    0.2152
R:TGCTTCAGTTCCAAACGAAA
ZJU124ab JQ318819 (CT)10 F:<HEX > <Tail-4 > GTGGCAGCCTCTCTATCGTC 161-187 12 0.9355 0.8778 0.8498 0.0001
R:ATGACGTACTGCCCTTGCTT
ZJU125ab JQ318820 (TC)8 F:<HEX > <Tail-4 > TAAGGGCAGTCAGACCAACC 164-186 4 0.2188 0.3884 0.3453 0.0000
R:CTGCAGCCTACAATGATCCA
ZJU126ab JQ318821 (GA)10 F:<HEX > <Tail-4 > CCAATGTGGACAGGTGTGAG 173-193 11 0.9677 0.8535 0.8228 0.0000
R:GGCAGTAGTCGCTTCCCATA
ZJU127 JQ318822 (GC)10 F:<HEX > <Tail-4 > AGGATCCTTGTCACCACCAG 165-189 11 0.9259 0.8288 0.7900 0.0079
R:AATTCTTCCTTCCCAGCCTC
ZJU128ab JQ318823 (AG)14 F:<HEX > <Tail-4 > CCCAATTGACACAAATTCCC 145-161 5 0.4194 0.5019 0.4496
    0.1981
R:TTGGCATAGCATTGTTCGTC
ZJU129ab JQ318824 (CT)10 F:<HEX > <Tail-4 > GAGGTGCAATTACGTGGCTT 161-189 10 0.7500 0.8031 0.7611 0.0234
R:TCAAGCATCAGCTGCTCAGT
ZJU130ab JQ318825 (GA)8 F:<HEX > <Tail-4 > GATTGCATGCACCAAATCAC 160-176 5 0.3478 0.4599 0.4131
    0.2852
R:GAATGTCCACGACGTGAATG
ZJU131ab JQ318826 (CT)14 F:<HEX > <Tail-4 > TTGAGAATCACAAACGCCTG 153-187 13 0.8710 0.8990 0.8735 0.0009
R:GGTGGGTGAAATGCCTAGAA
ZJU132ab JQ318827 (CT)11 F:<HEX > <Tail-4 > AGGCACCTTTCTTTCCTCTC 164-178 5 0.6452 0.6568 0.5834
    0.6586
R:CAAGGAAGGAGGTGACGAAG
ZJU133ab JQ318828 (TC)11 F:<HEX > <Tail-4 > GCCCTGCAGTCTTTGTCAAT 171-195 8 0.8710 0.7731 0.7267 0.0000
R:CAGCTTGCAGTGTTCATTCA
ZJU134ab JQ318829 (GA)11 F:<HEX > <Tail-4 > AGTGCCCAAGCATGACTTCT 172-190 8 0.9688 0.7907 0.7507 0.0004
R:AATCAGTTGTCCGAGGATGG
ZJU135ab JQ318830 (AG)10 F:<HEX > <Tail-4 > AATTTACGGCTGTCCGTGAG 173-191 10 0.9688 0.7966 0.7557 0.0000
R:CCTTGGGCTTCATGAACATT
ZJU136ab JQ318831 (GA)10 F:<HEX > <Tail-4 > TCCCACAGATCTCTAGCCGT 173-201 13 0.7742 0.8953 0.8692 0.0004
R:CGCTCAGTTCTTAATTTCTTACTGTC
ZJU137ab JQ318832 (TC)8 F:<HEX > <Tail-4 > TGGATCTTGCTGCAGTTGTC 140-168 12 0.1875 0.6930 0.6612 0.0000
R:AGCTAGCACTGGCCTAACCA
ZJU138ab JQ318833 (CT)10 F:<HEX > <Tail-4 > GCACAGTTGAGTTATGGGCA 152-170 8 0.3333 0.7746 0.7261 0.0001
R:CTCTTTCAAATCCACGCACA
ZJU139ab JQ318834 (GA)12 F:<HEX > <Tail-4 > CCGAGCTTCGTTAGGACTTG 138-164 6 0.3667 0.4418 0.4043 0.0000
R:CCAACAATACCCGAACCATC
ZJU140b JQ318835 (CT)14 F:<HEX > <Tail-4 > TGTGCTCATCTTGGATCCTG 172-198 9 0.6538 0.6139 0.5474 0.0000
R:ACATCAGCTTGCATCCCTCT
ZJU141ab JQ318836 (CT)13 F:<HEX > <Tail-4 > CACAATCAGCTGCAGAATCAA 175-201 11 0.6774 0.7996 0.7600 0.0002
R:AATGGCCGCTTGCAATATAA
ZJU142ab JQ318837 (TC)13 F:<HEX > <Tail-4 > CATTCACCTCCTTTCGCAAT 166-184 9 0.6774 0.6912 0.6498 0.0231
R:ATCCAACGGCTCAAAGAATG
ZJU143ab JQ318838 (CT)12 F:<HEX > <Tail-4 > GTAGAGTAGATGCGCCTCGG 181-197 7 0.6923 0.7044 0.6397 0.0000
R:ACGTACGAGCCATACACACG
ZJU144ab JQ318839 (AG)12 F:<HEX > <Tail-4 > GCCACTCTTCCCTCAACGTA 148-164 7 0.5161 0.6864 0.6252 0.0430
R:CAGGTCAGTCCTGATGGGAT
ZJU145ab JQ318840 (CT)10 F:<HEX > <Tail-4 > TGTGGCTGTGTTCCTCCATA 155-175 7 0.6875 0.7351 0.6912 0.0000
R:CAATGTTGGGTGCTTTGTTG
ZJU146ab JQ318841 (AG)10 F:<HEX > <Tail-4 > TGGAAACTTTGTCGTGTGGA 154-168 6 0.2258 0.6663 0.6187 0.0000
R:TTATATCGGGCAGCCAGAAC
ZJU147ab JQ318842 (AG)10 F:<HEX > <Tail-4 > TTAGGAACCAAACTGGACGG 173-195 10 0.8333 0.7169 0.6811 0.0005
R:TCAAATGCCGTGCTATTGAG
ZJU148ab JQ318843 (AG)18 F:<HEX > <Tail-4 > AAGAGCAGGAACCGAACCTT 160-190 15 0.9375 0.9067 0.8829
    0.4973
R:ACCGAAAGACGAAGAAACGA
ZJU149ab JQ318844 (TC)8 F:<HEX > <Tail-4 > AGCCCTCCATGTGTGCTTAT 139-163 11 0.8333 0.8718 0.8417 0.0022
R:AGGGAGAGAGTGGTTCTGCC
ZJU150ab JQ318845 (AG)10 F:<HEX > <Tail-4 > ACTTAACTGAGAGGCTGCGG 163-201 10 0.9000 0.8469 0.8123 0.0053
R:GTGGAAACCGAACGTCCTAA
ZJU151ab JQ318846 (CA)9 F:<HEX > <Tail-4 > GAATTGGAAATCCCTAGCCC 156-170 6 0.3750 0.5511 0.5188 0.0001
R:CATTTGCGCATGTCTCCTTA
ZJU152ab JQ318847 (AG)11 F:<HEX > <Tail-4 > AAACGAAGTCGTTCAATGCC 163-181 7 0.9355 0.7578 0.7040 0.0161
R:CTTGATTTGGGCCTTCGATA
ZJU153ab JQ318848 (AG)10 F:<HEX > <Tail-4 > CCAGCTCCGAATTAGCAAAC 173-191 6 1.0000 0.6667 0.5927 0.0000
R:GTGGCGGTTTATCTCATCGT
ZJU154ab JQ318849 (AG)11 F:<HEX > <Tail-4 > TTGTCAATTGCCCTTCCTTC 156-184 10 0.9333 0.6847 0.6184 0.0000
R:TTCCTCCCTTTCCCACTTCT
ZJU155ab JQ318850 (TC)9 F:<HEX > <Tail-4 > GAGAGCAATCAGTGAAGCCC 160-188 8 0.8438 0.6731 0.6037 0.0000
R:GGGAGACGGATGTCGATTTA
ZJU156ab JQ318851 (TA)8 F:<HEX > <Tail-4 > ATACGTCGAAAGATCCACCG 166-184 7 0.5484 0.6626 0.6063 0.0000
R:TTCTGGAATCCTTCCCATTG
ZJU157ab JQ318852 (AG)9 F:<HEX > <Tail-4 > CACTCACAACCAAAGCCAGA 154-186 13 0.9677 0.9064 0.8823 0.0171
R:GTGCATAATCACAGGCATGA
ZJU158ab JQ318853 (AT)10 F:<HEX > <Tail-4 > CCAGATGATCACGCAGCTTA 156-174 9 0.6452 0.8292 0.7917 0.0000
R:CGTCCTCCAATACGTTCCTC
Mean 8.25 0.5636 0.7178 0.6730

Note: a b c These SSRs are transferable for M. adenophora, M. nana and M. cerifera, respectively. SSR markers are listed according to ascending order in different fluorescent dyes. Shown for each primer pair are the repeat motif, primer sequences, size range (bp), number of alleles detected (Na), observed heterozygosity (Ho), expected heterozygosity (He), polymorphism information content (PIC) and Chi-square test for Hardy-Weinberg equilibrium (PHW). The annealing temperature was 60 °C; a, including length of tail sequences (18 bp total). PHW over 0.05 are underlined.

Jiao et al.

Jiao et al. BMC Genomics 2012 13:201   doi:10.1186/1471-2164-13-201

Open Data