Table 2

Primers and restriction enzymes used in generating 21 SBP markers

Ch.

No.

Name

Primer sequence

Restriction enzyme

Amplicon

size (bp)


1

SBP1_0.95

F:GTCAGGCTAGCTCATCAAGTCCTAC

R:CCGGATTTCGCCAGCTCCGTC

Tsp509I

100

1

SBP1_5.25

F:CACAAACCCTTCACCTCCAT

R:GCAGTTGCCTAAAGGCTGAG

MspI

233

1

SBP1_8.08

F:AACGCAATTCTCAAGCAGGT

R:CATTCAATTGTTGGGCAGTG

RsaI

188

1

SBP1_11.09

F:AAAGTCAACCGGGAGGTTTC

R:AGGCTGAGGACACGAGAAGA

BamHI

163

1

SBP1_18.63

F:GCACTTGCAAAAGGAAGCTC

R:TTCTTGCTGGAGAATCGTGA

RsaI

197

1

SBP1_22.30

F:TACCGGTTCCGGTCACTATC

R:AATGGGAAATTGGGATTGGT

DdeI

151

1

SBP1_25.92

F:TTGTTGAGAGAGCGAGATCAAA

R:AAAAGCATCACATCATCTTTGG

NheI

102

2

SBP2_14.07

F:GAAGGAATTGGACCAAACGA

R:ATCTAGCTGCCCTCACTGGA

BtsCI

213

2

SBP2_16.23

F:CACCATTTGTTCCCGTAAGC

R:TGGTCAATCCATGGTGATGT

Hpy166II

157

3

SBP3_6.60

F: CCATCGTCCTATTCTAATCCATGTTG

R: GATGCAAAATCTCCATCCTCTTC

Tsp509I

379

3

SBP3_8.11

F:CACGTATCGGCGAGTCTACA

R:CAAATTCAAATCTCAGTTTTCGTC

TaqI

150

3

SBP3_10.28

F:TCTAAAACGAACCGGGAAAA

R:CGACAAGTAAATTAAAACCAACCTG

MboII

151

3

SBP3_11.12

F:AAGACTTTGGTTCAACTCCTGAA

R:GGCTTTGGATTCAGGAAAAA

TaqI

184

3

SBP3_23.46

F: CGACCAAATGTCTCTGAGATGTTC

R: CACCCAAGGCGGTGTTGGCGAAAG

TaqI

520

4

SBP4_0.67

F:CGGTTAACATGCCTCAATCC

R:TGTGGATGATTTGGGGACTC

DdeI

171

4

SBP4_2.91

F:CGAGTGACTTCTTGAGGTTTATTATG

R:CGAGATTGCTTTGGTATGGA

Hpy166II

249

4

SBP4_5.60

F:AGGGAAGAATATGCGGAAGG

R:TGTTTCTGTCTTGGCCCATT

TaqI

159

4

SBP4_6.51

F:GGACAAGACCTTGATTTGAAGTTTG

R:GAGGGCTCACATTGGGTTTAATG

Tsp509I

395(C), 490(N)

5

SBP5_8.40

F:TCGACGGTGACTTGTAGGTG

R:CGATGCCGTCTCATAAAAGG

DpnI

232

5

SBP5_14.60

F: CGCGGTTATGGTAACGTTAAATG

R: CCGAGGGAGAAGAAAGGATCAAGAAG

HphI

225

5

SBP5_25.00

F:AAATCACCAATGGCAAAACA

R:TTTGCGTAGACGGAGAGTGA

DdeI

191


Restriction endonucleases used for generating individual SBP markers are shown. F, forward primer; R, reverse primer; C, Col-0; N, Nd-0.

Sahu et al. BMC Genomics 2012 13:20   doi:10.1186/1471-2164-13-20

Open Data