Table 3

Primers for q-PCR analysis

Genes

GenBank accession no.

Forward primer (5' to 3')

Reverse primer (5' to 3')

Product size(bp)


MrSPS1 (4705)

JR053938

TGTGATCCTGAAGGGTGTGG

CGAAGCTCGAATGTCGTTGC

139


MrSPS2 (9305)

JR053939

TTGATGGAAAGAACAGAGCT

TTTCAAGAAGATCTGAGGAT

192


MrSPS3 (19164)

JR053940

AGGGAGAGGAAGCTCAGCAT

GAGCAGAAATATCACTAACC

132


MrGAD1 (113)

JR053944

CCTGTATTTGGGCTTGGTA

ATTTCTCATTTCGAGTTCC

182


MrGAD2 (4648)

JR053945

GTTAAGAGGTTTGTCCTGT

GGTTAGGTAAACTAGTCCAA

160


Feng et al. BMC Genomics 2012 13:19   doi:10.1186/1471-2164-13-19

Open Data