Additional file 2.

sup2.pl. Custom script used to remove index sequences and rename the header with the appropriate sequence. USAGE: sup2.pl {Reads FASTA format file} {Primers/MIDs/Barcodes with corresponding headers in csv format} {# bases from start of primer to the beginning of the barcode} {New FASTA filename to be written into} Example: Input (fasta file): >1300_8769_5430 length = 258 urnand = JHSK987KJSH2KJHJK8777 AGTCCCCCGGGGTTTAAAGGGGCCCCTTTTAAAAAAGTCGTCAATGCGGT AGTCTGCAAAAAAATTTCCCCCCCCCCGGGGGGGGGGGTAGCCGTATGCA Input (MIDs csv file): Sample1,ATAGTGA Sample2,ATGCATG Output: A fasta file of the remaining sequence after removing the primer/bar code/MID with corresponding header attached as specified in the input "MIDs csv" file.

Format: PL Size: 4KB Download file

Koepke et al. BMC Genomics 2012 13:18   doi:10.1186/1471-2164-13-18