Table 1

Previously unpublished primer sets mapped in the interspecific Allium cepa x A. roylei population
Primer Set Genbank Accession FORWARD PRIMER REVERSE PRIMER
ACABE58 CF447676 TCTTCGAGAACTATCCCGACAT ACTCAACCGCTGTTACAAGGAT
ACI017 AY585678 CCGACTACATGTAAGTTGCATTAAC TCTTGCATAATTTCACTGCACA
ACM005 BI095610 CGCTTCAGCAGTGAGTTGTT TGTTGTCCGATACAGAGTTGCT
ACM021 CF448154 AAAACCCTCAACATCTCACTCC TCTCTTCTTCCTCGTCCTGC
ACM037 CF438925 GACCGACTCCAAAGCCATA CTCTCCCGTTCTCAAAATGC
ACM049 CF447728 TAACGACATCCCTACCGC GCTTCTTCTTCCACTTTCGG
ACM050 CF447828 GGTTCTCTGTTTGGGACA CCGTTTCGGCTACCTTGTAT
ACM052 CF441811 CAGCAGCAACAAAGAATGC CTGGGGAGAATGAGAAGCAC
ACM053 CF437211 CTGGGCTCTTTTGTTCATCC ATGGTGGAGGTATGTGAGGG
ACM058 CF435771 GGAGTCACACAACAGAAACACAA AAGAAGGAATAGAGATGTAGCCGA
ACM060 CF435985 ATCAGCAGCCTTCCCAGTAA ATCACACCCGCAAAAGAAT
ACM065 CF449328 GCTCTGATGGAGGATGGTTC CTTGCCATCTTTGTCGGT
ACM072 CF441584 TGAATTCAGGCCAAACATGA GAGGAAAGCCTGAAGAGTAGCA
ACM076 CF449018 ATTAGAAACATCCATCGCCG CGCGATCATCATTTTCCATA
ACM080 CF449761 GCATTATGCAGTAACGGGCT GCAGCAGCATTTGATTGAAC
ACM081 CF447998 CTGAAAAGAAACCCGCAGAG TCAGGATGCACTTGCTTCAG
ACM082 CF436620 CACCGTTCCTCAGCTCACTT AGAGGGACGAAATGAAAGCA
ACM092 CF451134 GTGATTTGAAGCCACCACCT TGAATGGTGGTTATTCGGGT
ACM096 CF446191 TGTGGGCAATTCACGTTATG AAAAGTTGTGAACGGCATCC
ACM105 CF441894 CAAGTGGAGCGGGTATTTGT GAGGCACAACTTCCTCTTCG
ACM107 CF449837 CCTTCATTCCCAAAGCACAT GCGATAAAGAGGGACAGCAG
ACM114 CF436720 TAAGTTTTGCCTCCACCACC GCTCCACTTCAAGGCTGTTT
ACM129 CF442903 CTAGGTTTCCGTGCTCCAAG CAGTTGGAGATCAACAGGCA
ACM140 CF442000 TTGAAGCTATTCTCCGCAGC AGGGGGTCATTGATCCTAGC
ACM144 CF441789 GCAACGGTAGAAGAACCTGC AACCTCTTTTGGTGCCTCCT
ACM149 CF440830 GAAGATGGGTTTGAGTGGGA CAAGCCTGCCCTTACTCTTG
ACM174 CF451831 TGCCCAATTATCGTTTCCAT GATGAGGCGAGTTTAGAGCG
ACM183 CF443106 GATGATGGTGATGGCATTGA GTTTGCAGGCTCCATTGATT
ACM231 CF441488 AAAGCTTCTACCCTGGCGAT TCCCTACGAACTCGTCATCC
ACM238 CF443464 TGATAGCCAGTTGATTGCGA TTCCCCAGTACACACCTTCC
ACM240 CF444554 GTGCAACTCCAAGAGAAGGG AATATAAAGGCGTTGGCCTG
ACM245 CF445289 GGATCTGATCGGAGATTGGA GCGCACCTCTCTGCTAGACT
ACM255 CF449065 AAATTCCCAAAACGAAACCC GGGTTTCAGGAACAGTCAGC
ACM295 CF445600 AGATCCGTCCCATGAAACT GATCCGCTTCTGAAATCTCG
ACM304 DQ273270 GAATTTAGGCCCATTTCAAGG TGATTTGCCTAATGTTTTTACG
ACM322 ES449660 TTCTTCTCCTATCCAGCTATCG GTGATTTGGGAGGGGATTTT
ACM340 CF437547 AAGTCTGGTGGTTGGTCCAG GGTGCCCAAGAAGTTGGTTA
ACP002 AA451591 AAGCTTCTTTCGATCCTTTGTG GCTTCGATTCCATTTCAAGTTC
ACP003 BE205590 AAGCTCTTAAAGCTGCTGATGG ATGCACGATAGCACAAGACATC
ACP034 BQ580357 CAGTCTTGTGGTCATTGGTCA AACCCATGCGTATTTGAAGG
ACP052 CF445805 TTCCCTCCTCACTCCCTACA CGACCACAAACACAAGCAAC
APSR AF212155 CAGCTGCAGACTTTTCCTAC CCACGTGATCGAGTAGATCGT
GGCS AF401621 CTGGAGTCACACCTGCAGAG TCGCCTTCGGAACTGTTATT
GGT AF401622 TGTTGCTACCGATGATGGTC ATGCAACCCTGCAATTTCTC
SPS3'UTR EU164758 AAAGGGAGATACAGACCAT ATTATACATCTCATCATGTCACT
SUCS CF440928 TTTGAAGTGTGGCCTTACCTTGAG TGATGAAGTCTGTTCGATCATGGC

McCallum et al.

McCallum et al. BMC Genomics 2012 13:168   doi:10.1186/1471-2164-13-168

Open Data