Table 6

Effects of SNPs located in the 5' UTR of SLC2A1, HK1 and ESR2 on predicted miRNA binding sites.

Entrez Gene ID/Ensembl ID

Chromosome

Position

Allele

Strand

miRNA name

miRNA sequence

Free energy ΔG1 (kcal/mol)


T

(+)

bta-miR-10b

uacccuguagaaccgaauuugug

-20.7


SLC2A1

3

110250920

bta-miR-136

acuccauuuguuuugaugaugga

-22.0

G

(+)

bta-miR-1249

acgcccuucccccccuucuuca

-21.5

bta-miR-2284r

uuggcccaaaaguucguucggau

-21.3


HK1

28

24994609

T

(+)

bta-miR-2465

ugagccacaguagagccuuggau

-21.9


ESR2

10

78593544

A

(-)

bta-miR-2348

uucgggugguguggagcggcc

-21.9


1Free energy: Gibbs free energy (ΔG) of the duplex structure is indicated.

Mullen et al. BMC Genomics 2012 13:16   doi:10.1186/1471-2164-13-16

Open Data