Table 1

Primers for qPCR

GenBank

Forward Primer

Reverse Primer


AB109635

GGCACCAACTTGCTACCACA

GCTGCAAGAGCTGCCATTAG


AF505881

CCAGCTACATCTCCCACCTG

TCTGTTTGGGCTGGGAGTTC


BX932962

GTACAACCACGTTGGGCAGA

CTCTCGCGTTTCCTTTGAGG


BX931297

TTGTGGCCTACCCCAGATGT

GGATGGGACTTTCCAGAGCA


BX931599

CTGTTTCCTGACCGCAGTTC

AGCACAAACTCCGCCATTTT


BX933478

CCTGTGCAAGGTGTCCAGTG

CCCAATGGCCATACAGTTCA


BX933728

GCAAAGCACCATCCCAAATA

TAT TGAGGCGCTGACTCCTG


BX933888

CTGGGATCCCTCCAGAGCTA

CCATTCACTGGAGCACCAAA


BX935456

CGAGGCCATCAACTTCCTTC

TCCACATGACGCACATACCC


BX936211

CCAGCTGTCCTCCTTGGAAT

AGGGAGAGGAAGACGTGCTG


CR352775

GGCCTTGAATGACCATCATGT

AACAGCAGCAGGAACAGTGC


CR385566

CGCGCTCTACGACTACATGC

CTGGGTGGTGATCTCGGTCT


D87992

TGCAGCACTGAGACCTGGAT

CAGTTGCTGCGGATGAAGTC


M60853

TTTTGGCTACCAGTCCAGCA

TTCGCAAGTGTTCCCCAGTA


M64990

TGCTCCCCTGAGTACTGGAA

GCCTCTGTGGGTTCAGGATT


M80584

TCCCACTGAGCAGCTTCTGTA

CCAGAGAGATATCCGCAGCA


M87294

GGTGCTGACTTTCGCCTTGT

GCCTGGTGATGAGGTTGATG


X87609

CCACCTGAGAAAAGCGACCT

ACATCGACCTCTGCCAACCT


Lee et al. BMC Genomics 2012 13:143   doi:10.1186/1471-2164-13-143

Open Data