Table 1

Conserved miRNAs identified in P.densata

miRNA gene

miRNA sequence (5'-3')

Arm

Length (nt)

A + U (%)

Folding energy

MFEI

RT-PCR

qPCR

*Conserved in other plants


ath

osa

ptc

vvi

pta

pab


pde-miR159a

UUUGGUUUGAAGGGAGCUCUAa

3'

21

53.5

-94.74

0.89

+

+

+

+

+

+

+

pde-miR162a

UCGAUAAACCUCUGCAUCCAG

3'

21

45.0

-49.10

0.80

++

+

++

++

pde-miR166a

UCGGACCAGGCUUCAUUCC

3'

19

45.8

-49.10

0.96

+

+

+

+

+

++

+

+

pde-miR166b

UCGGACCAGGCUUCAUUCC

3'

19

48.8

-43.40

1.01

+

+

+

+

+

++

+

+

pde-miR169a

CAGCCAAGGAUGACUUGCCUAa

5'

21

58.3

-48.80

1.14

+

+

+

+

+

pde-miR171a

UGAUUGAGCCGUGCCAAUAUC

3'

21

55.2

-55.20

1.28

+

+

+

++

++

++

+

pde-miR390a

AAGCCCAGGAUGGAUAGCGCC

5'

21

53.7

-40.50

0.92

+

+

+

+

+

++

pde-miR396a

UCCCACGGCUUUCUUGAACUUa

5'

21

55.1

-43.28

0.90

+

+

+

+

+

+

pde-miR482a

UCUUUCCUACUCCUCCCAUUCC

3'

22

52.3

-60.90

0.98

+

+

+

+

++

+

++

pde-miR482b

UCUUCCCUAUUCCUCCCAUUCC

3'

22

52.1

-60.30

1.04

+

+

+

+

+

++

pde-miR482c

GGCUUGCGAGGGUAGGAAAAGa

5'

21

48.9

-45.20

0.90

+

+

+

+

+

pde-miR482d

CCUUUCCAACGCCUCCCAUGCCa

3'

22

54.8

-46.50

0.76

+

+

+

+

+

+

pde-miR783

AUUCUUUGCUGGUUCAUUUUC

3'

21

57.0

-26.80

0.67

+

+

pde-miR946a

CAGCCCUUCUCCUAUCCACAA

3'

21

59.3

-71.50

1.02

+

+

++

pde-miR947

CAUCGGAAUCUGUUACUGUUUC

3'

22

48.7

-70.70

0.94

+

++

+

pde-miR949a

UCUCUAGGAAUCAAAUGUGUCa

5'

21

47.7

-41.80

0.91

+

+

pde-miR949b

UCUCCGGGAAUCCAAUGCGCC

5'

21

46.3

-66.30

1.12

+

++

pde-miR950a

UCUGGUCCACGGUGGUUUAUa

5'

20

57.2

-40.90

1.05

+

+

+

+

pde-miR951

UGUUCUUGACGUCUGGACCAC

5'

21

54.8

-43.00

0.83

+

++

+

pde-miR952a

AACAGAGCAUGCCAUUGGUGa

5'

20

54.0

-232.79

0.96

+

++

pde-miR952b

AACAGAGCAUGCCAUUGGUGa

5'

20

53.9

-214.40

0.99

+

++

pde-miR952c

AACAGAACAUGCCAUUGGUGa

5'

20

54.2

-192.12

0.90

+

++

pde-miR1310

GGCAUCGGGGGCGUAACGCCCU

5'

22

47.0

-35.00

0.80

+

++

pde-miR1311

UCAGAGUUUUGCCAGUUCCGCC

3'

22

48.8

-43.40

0.99

+

+

++

++

pde-miR1312a

UUUGGAGAGAAAAUGGCGACAU

3'

22

62.8

-41.50

0.81

+

++

pde-miR1313

UACCACUGAAAUUGUUGUUCGa

5'

21

58.6

-66.72

0.71

+

+

+

pde-miR1314a

CCGGCCUCGAAUGUUAGGAGAAa

3'

22

56.2

-42.30

0.92

+

+

+

pde-miR1448

CUUUCCAACGCCUCCCAUGCa

3'

20

54.8

-46.50

0.76

+

+

pde-miR2118a

UUUCCAACGCCUCCCAUGCCUAa

3'

22

54.8

-46.50

0.76

+

+

pde-miR2118b

UUCCCUAUUCCUCCCAUUCCUAa

3'

22

49.4

-42.00

0.98

+

+

pde-miR3701

UGAACAAUGCCCACCCUUCAUCa

3'

22

59.3

-84.10

1.07

+

+

pde-miR3704a

GGUCUCGGUGGAGUUGGGAAGAa

5'

22

53.8

-49.00

0.98

+

+

pde-miR3704b

GGUCUCGAUGGAGUUGGGAAGAa

5'

22

54.7

-46.40

0.95

+

+

pde-miR3712

UGUGAUCAAGAUCAGACUCCCAa

5'

22

59.4

-15.00

0.54

+

+

0.92

± 0.15b


*Ath, osa, ptc, vvi, pta and pab are the abbreviations for A. thaliana, O. sativa, P. trichocarpa, Vitis vinifera, P. taeda and P. abies, respectively. The plus symbols indicate: ++, miRNAs identical to known miRNAs in other plant species; +, miRNAs homologous to known miRNAs in other plant species. a is a novel member of corresponding miRNA family. b 0.92 ± 0.15 is the average and standard deviation of MFEI values of pre-miRNAs.

Wan et al. BMC Genomics 2012 13:132   doi:10.1186/1471-2164-13-132

Open Data