Table 5

Primers used for the validation of gene expression and alternative splicing

Gene

Primer sequence 5'→3'

Amplicon size (bp)


Primers for gene expression validation


GBG5

F: TCCAGCGTCGCGGCTATGAA

94

R: TCAAATCTGCAGCTGCCTGGGA


PGP

F: TGAAGCGGCTGGGCTTCCCTAT

131

R: GGGCACCAACATGGACAACCGA


QOP5F6

F: TGGTGACGTGCACCCGAATGA

112

R: AGCACCCACGATGGGGAAGATC


CFL1

F: TGGTGTCGACGACTTACGCACT

132

R: AGCGCCTCTCGTCTTGTAGGCT


B4GALT4

F: TGATACCGGCCTCTGTGCACCT

113

R: TGCCCTTCTGTGTCTCCACACCT


MYL7

F: ACCCCAGTGGTAAAGGCGTGGT

115

R: TCCATGGGTGTCAGGGCGAACA


DUS6

F: GGGCGAACTCGGCTTGGAACTT

118

R: AACGAGAATACGGGCGGCGA


Primers for alternative splicing validation


AP2B1-F1

GCCTAGATAGTCTGCTTGGCA

134

AP2B1-R

ACCACTGCTGACCACAGC


AP2B1-F2

GCCTAGATAGTCTGGTGGGA

92

AP2B1-R

ACCACTGCTGACCACAGC


ZDHHC16-F1

TGCTGCCATCGAGACTTA

97

ZDHHC16-R

GCACAGGAACCAGAGGTAGAC


ZDHHC16-F2

CGACAAGAACAAACTACAGG

118

ZDHHC16-R

GCACAGGAACCAGAGGTAGAC


Driver et al. BMC Genomics 2012 13:118   doi:10.1186/1471-2164-13-118

Open Data