Table 1

Pairs of primers that were used for validation of array data

Gene name

Accession number

Forward (5' - 3')

Reverse (3' - 5')

Annealing temperature (°C)

Product length (bp)


GDF9

NM_174681

AGCGCCCTCACTGCTTCTATAT

ACACCCTCAGCAGCTTCTTCTC

57

152

MSX1

NM_174798

AAGGTATCCACAGTCCCCAGC

TCTGCCTCTCCTGCAAAGTTC

56

180

IRF6

NM_001076934

GGACTCCAAACGCTTCCAGA

TCCTTGGTGCCATCATACATCA

54

212

SPARC

NM_174464

CGATGATGGTGCTGAGGAAA

TGGTGGCAAAGAAGTGGCA

53

220

HPSE

NM_1744082

ATGGGCATAGAAGTGGTGATGA

TGTTTGGTGTTTGTGCAATGAA

TD 54-50

202

DGAT2

NM_205793

TGAACCGGGACACCATAGACTA

CACCTCATTCTCCCCAAAGGA

55

205

SOX2

NM_001105463

GCGGCAACCAGAAGAACAG

GCTTCTCCGTCTCGGACAAA

55

170

HAS2

NM_174079

CCAAATGAAATGCCAAAGGAA

CAACGTCAACCAAGCTTCACA

TD 54-50

237

PTX3

NM_001076259

TTTATTCCCCATGCGTTCCA

CTCCACCCACCACAAGCATT

53

205

IGF2BP3

XM_588560

GACGCGAAAGTGAGGATGGT

TGCACTTGACAAATTCTGGAGC

54

215

ADAMTS1

NM_001101080

TCGTCATACAGCTCCCCTCC

ATTGACACACCATTTCCCCTCT

TD 57-54

220

PDK4

XM_583960

ATTTTTGCGACAAGAGTTGCCT

GGATTCCTTGTGCCATTGTAGG

TD 56-52

250

CCRK

XM_879150

GGCCCCACTCATGGCTACTT

TCCTGAGGGTGATGCTGGTAA

57

170

FOSB

XM_880646

TTCCTGAATCTCTCCCGCC

TGCTCACAGCCTCACACTCG

56

205

POU5F1

NM_174580

AGAAGGGCAAACGATCAAGC

GGTGACAGACACCGAGGGAA

TD 57-53

205

VEGFA

NM_174216

GGTTTCGGGAACCAGACGT

GGCAATCCAATTCCAAGAGGA

55

233

18S

NR_003286

GTGCCCTTCCGTCAATTCCT

ACGAAAGTCGGAGGTTCGAA

55

184

GPT

XM_585516

CCGATGAGGTGTACCAAGACAA

CCATATTCACCACCTCCACGT

55

185

DAPL1

NM_001025346

AAATTTCCAGCAGTAGCGCAC

AGCTCTCAGACATTCGAGGCA

55

158

IRF7

NM_001105040

CTCCCCGCACTACACCATCTA

GCCTGTTCCACCTCCATCA

TD 58-55

245

GADD45A

NM_001034247

GACCGAAAGGATGGATAAGGTG

TGGATCAGGGTGAAGTGGATCT

56

200

DPP4

NM_174039

CAACTGGGCTACTTACCTTGCA

TTACGTACCCTCCGTATGACCA

56

223

IFI6

NM_001075588

ACGGTGACAAAGCCTTGAGC

AGGTCACCATGCCCCAGAA

55

158

ADAMTS4

NM_181667

CCATTGTGGAGGATGATGGG

AGGAAGTCAGTGATGAAGCGG

55

210

CASP1

XM_592026

CTCACTCAGAGCATCGGACCT

GTTTACCCATACCATCCCTTGC

57

229

IFIT5

NM_001075698

CACAGTGTATCGGCTGGATGA

GGTTGGGCTGATATCTGGTCC

56

200

DDX39

NM_001034752

GCAGTTCAAGGACTTCCAGC

GCTCTGCCACATTCACTTCA

TD 55-52

228

GTF2A2

NM_001037619

AGAAAGAGGTTCTGCCCGGA

CTTATCGGCTGCATTGAAAGC

55

150

TSSC1

XM_001789233

AGCAGCGACAGCAGAGTCATC

TAGCTCAGGGAGGCGAACAG

57

229

FSHR

NM_174061

GCTGGATCTTTGCTTTTGCAGT

ATGCGCTTGGCTATCTTGGT

54

243

GPT

NM_001083740

CCGATGAGGTGTACCAAGACAA

CCATATTCACCACCTCCACGT

56

185

PLAUR

NM_174423

GGATTCCACAACAACCACACCT

TCGCTTCCAGACATTGATTCAT

TD 56-52

204

CA2

NM_178572

CAAAGCAGTGCTGAAAGATGGA

AAAACACCCACAACAGCCAGTC

55

212


Touch down (TD) = The forward and the reverse primers of a given gene have different annealing temperatures

Regassa et al. BMC Genomics 2011 12:57   doi:10.1186/1471-2164-12-57

Open Data