Table 4

Primers used in real-time PCR amplification of bacteria and host gene.

Gene

Primer sequence 5'-3'


Sulfide oxidizer symbiont 16S

Forward GAGTAACGCGTAGGAATCTGC

Reverse CGAAGGTCCTCCACTTTACTCCATAGAG

Methanotrophic symbiont 16S

Forward GTGCCAGCMGCCGCGGTAA

Reverse GCTCCGCCACTAAGCCTATAAATAGACC

Cytosolic malate dehydrogenase (host)

Forward ATGGAGGAAAGAGATATGGCACTGAGCGT

Reverse TAACATTAAACATAGCCTAGGAACCTAATG

ATP sulfurylase (SOX)

Forward GTGCGTGATGCCGCTATCCGCACCATG

Reverse GGTCCGGCATAGAGCATGTCAAACGGATA

Particulate methane monooxygenase A (MOX)

Forward GAGTGGATTAACAGATATTTGAACTTCTGG

Reverse CATACCACCAACAACAGCTGTAAGTACAAA

Ribosomal protein L15 (host)

Forward TATGGTAAACCTAAGACACAAGGAGT

Reverse TGGAATGGATCAATCAAAATGATTTC


Boutet et al. BMC Genomics 2011 12:530   doi:10.1186/1471-2164-12-530

Open Data