Table 2

Primer sequences for RTPCR validation.

Gene Name

Forward Primer Sequence

Reverse Primer Sequence


AIF1

CTCCAGCTTGGTCTGTCTCC

TCATCCAGCCTCTCTTCCTG


CACNB1

ACGTCCTCGGATACCACATC

CGGTCCTCCTCCAGAGATAC


CASP10

CTTTGGACCTTGGAGCACAC

GAACTGGAATACCAATGTTGACC


CTTN

GAAACAGGACCAAAAGCTTCC

CATCTGGACACCAAACTTGC


EDEM3

GAATTTGAAGATGCAGTGAGAAAA

AACTGCTTTGCCATTTGGAG


HAP1

GATGGAGGAGAACAGCAAGC

GAATCTGAGTAGAGCTGGAGGAG


IL12RB1

CTGCCTGCAGAACCAGTGAG

CAGCTGTGGGACCCTCATAC


LAMA2

TGTTTCTGTTCAGGGGTTTCA

TGCTGATCTGCTGAGGTGAG


MTNR1B

TCTTGGTGAGTCTGGCATTG

TTGAAGACAGAGCCGATGAC


NEUROG2

CAAAGTCACAGCAACGCTGA

GAGCAGCACTAACACGTCCTC


NFKB2

CCCTCCCATGGAGGACTG

ACCAGACTGTGGGCATGAG


NRXN1

TCAGGAAATTCGCTTTGACC

GTGTTGGTGATGCATTTTGG


OPN4

ACCCAGCTGGTGGGACAG

CTGTGCCCAGGGTATAGTGG


OR2B6

TGAATTGGGTAAATGACAGCA

CATGGGGGTATGAAGTTTGG


PROK1

CACCCCAAGTGACCATGAG

CTCGAAGCCACAGGCTGAT


SRC

AGATCCGCAAGCTGGACA

CTGAGTCTGCGGCTTGGAC


TBX1

GTGTGAGCGTGCAGCTAGAG

TCCATGAGCAGCATATAGTCG


TGFA

CCTTGGTGGTGGTCTCCAT

CGGTTCTTCCCTTCAGGAG


TLR1

AGGCCCTCTTCCTCGTTAGA

AATGGCAAAATGGAAGATGC


RPL13A

GGGAAGGGTTGGTGTTCAT

GGGAAGGGTTGGTGTTCAT


ACTB

GCCGTCTTCCCCTCCATC

CGTCCCAGTTGGTGACGAT


TBP

CGGCTGTTTAACTTCGCTTC

CCAGCACACTCTTCTCAGCA


Forward and reverse primer sequences for 19 experimental and 3 reference genes used for RT-PCR to validate microarray results are shown.

Chow et al. BMC Genomics 2011 12:449   doi:10.1186/1471-2164-12-449

Open Data