Table 7

Probes used for the RT-qPCR measurements

Gene

Direct oligonucleotide

Reverse oligonucleotide

Product(bp)


PDC1

TAGAACTCCAGCTAACGCTGCTGT (1053-1076)

TGGGAAAGTGGTTTGGTTGATACC (1180-1203)

151

PDC5

GCCAAGTCAACTGTAACACCGTCT (44-68)

CAGCATAGGCAGCGTTCAATTCGT (149-173)

130

HXT6

GGGCTGTTTGGTCTTCATGTTCTTC (1497-1521)

CATTTCTTCAGCGTCGTAGTTGGC (1642-1665)

169

ALD5

AGCCAACAGTGTTTGCTGATGTCAA (1205-1229)

GCGGCTAACCCATATTGAGAATCAT (1322-1346)

142

TPS1

TCTCGTCCACCCGTGATGGTATGAA (1301-1325)

ATGGCATCAGAAAGATCATCGGTGT (1160-1164)

166

TPS2

GGGCAACTACGGATTCTATCCTGTC (2430-2454)

TCTGGAATCCAGGTCGACCGTACCA(2568-2592)

163

ATR1

TTATTAGTAGAGCCTTCCAAGGGC (494-517)

CAACCTAAAGTTCGTCCAATAGGG (601-647)

156

GRX2

CTACTCCAAAAATGGTATCCCAGG (92-115)

GGAACGTTCAATTCTTGGAAGAGG (210-233)

144

PEP4

GATAAGGTGGTCCCTCCATTTTAC (622-645)

AACAGGTAACCAAGTGATATCGCC (769-792)

173

TMT1

TGATTGAAGTTCCTTACGGGAAGC (494-517)

CTTTGTCTCTCACATCTTCTGCAC (629-652)

161

YMC2

GTTGACAGTATACCCATTGGACGTT (762-786)

CCAAACCCTTTGAAAAAGGCTCTGA (881-905)

146


The oligonucleotides were checked for specificity using the BLAST feature of SGD.

Livas et al. BMC Genomics 2011 12:405   doi:10.1186/1471-2164-12-405

Open Data