Table 2

Known plant miRNAs identified in melon

Annotation

Melon sRNA sequence (5'-3')

Similarity

Number of miRNA sequences

miRNA* sequences

Hit in melon genomea


miR156|a, b, c, d, e, f

UGACAGAAGAGAGUGAGCAC

100%

469

60

YES

miR157|a, b, c

UUGACAGAAGAUAGAGAGCAC

100%

269

0

YES

miR157|d

UGACAGAAGAUAGAGAGCAC

100%

19

21

YES

miR158|a

UCCCAAAUGUAGACAAAGCA

100%

1

0

--

miR159|a

UUUGGAUUGAAGGGAGCUCUA

100%

14651

0

YES

miR159|b

UUUGGAUUGAAGGGAGCUCUU

100%

18

0

--

miR159|c

UUUGGAUUGAAGGGAGCUCCU

100%

1

0

--

miR160|a, b, c

UGCCUGGCUCCCUGUAUGCCA

100%

537

0

YES

miR161|a.1

UUGAAAGUGACUACAUCGGGG

100%

6

0

--

miR161|a.2

UCAAUGCAUUGAAAGUGACUA

100%

1

0

--

miR162|a, b

UCGAUAAACCUCUGCAUCCAG

100%

825

0

YES

miR164|a, b

UGGAGAAGCAGGGCACGUGCA

100%

172

1

YES

miR165|a, b

UCGGACCAGGCUUCAUCCCCC

100%

4

0

--

miR166|a, b, c, d, e, f, g

UCGGACCAGGCUUCAUUCCCC

100%

65

27

YES

miR167|a, b

UGAAGCUGCCAGCAUGAUCUA

100%

136

0

YES

miR167|d

UGAAGCUGCCAGCAUGAUCUGG

100%

16

1

--

miR168|a, b

UCGCUUGGUGCAGGUCGGGAA

100%

967

0

YES

miR169|a

CAGCCAAGGAUGACUUGCCGA

100%

3

1

--

miR169|b, c

CAGCCAAGGAUGACUUGCCGG

100%

76

1

YES

miR169|h, i, j, k, l, m, n

UAGCCAAGGAUGACUUGCCUG

100%

83

1

YES

miR170|a

UGAUUGAGCCGUGUCAAUAUC

100%

3

0

--

miR171|a

UGAUUGAGCCGCGCCAAUAUC

100%

85

5

YES

miR171|b, c

UUGAGCCGUGCCAAUAUCACG

100%

64

0

YES

miR172|a

AGAAUCUUGAUGAUGCUGCAU

100%

85

58

YES

miR172|c, d

AGAAUCUUGAUGAUGCUGCAG

100%

4

0

YES

miR172|e

GGAAUCUUGAUGAUGCUGCAU

100%

3

0

YES

miR319|a, b

UUGGACUGAAGGGAGCUCCC

100%

2

3

YES

miR390|a, b

AAGCUCAGGAGGGAUAGCGCC

100%

32

6

YES

miR391|a

UUCGCAGGAGAGAUAGCGCCA

100%

1

0

--

miR393|a, b

UCCAAAGGGAUCGCAUUGAUC

100%

18

0

YES

miR394|a, b

UUGGCAUUCUGUCCACCUCC

100%

4

0

YES

miR396|a

UUCCACAGCUUUCUUGAACUG

100%

134

84

YES

miR396|b

UUCCACAGCUUUCUUGAACUU

100%

82

16

YES

miR397|a

UCAUUGAGUGCAGCGUUGAUG

100%

26

0

YES

miR408|a

AUGCACUGCCUCUUCCCUGGC

100%

14

1

YES

ath-miR2111a

UAAUCUGCAUCCUGAGGUUUA

100%

1

0

YES

peu-miR2910

UAGUUGGUGGAGCGAUUUGUC

100%

8

0

YES

osa-miR167d

UGAAGCUGCCAGCAUGAUCUG

100%

3401

1

YES

tae-miR395b

UGAAGUGUUUGGGGGAACUC

100%

1

0

YES

bna-miR397a

CAUUGAGUGCAGCGUUGAUGU

95%

77

0

YES

miR156|h

UUGACAGAAGAGAGUGAGCAC

95%

91

0

YES

miR156|g

ACAGAAGAGAGUGAGCACA

90%

5

0

YES

miR169|d, e, f, g

UGAGCCAAGGAUGACUUGCCU

95%

130

0

YES

miR169|d, e, f, g

UGAGCCAAAGAUGACUUGCCU

90%

112

0

YES

miR399|a

UGCCAAAAGAGACUUGCCCUG

95%

3

0

YES

miR403|a

CUAGAUUCACGCACAAGCUCG

90%

1

0

--


a Sequences with hit in melon genome = 'YES'; sequences with no hit = '--'

Gonzalez-Ibeas et al. BMC Genomics 2011 12:393   doi:10.1186/1471-2164-12-393

Open Data