Table 3

Structural features of CRISPR loci detected in the C. ulcerans genomes

Name

No. of cas genes

No. of spacers

CRISPR size

CRISPR consensus sequence in both genomes


CRISPR809_I

4

28

29 bp

CTTTTCTCCGCGTACGCGGAGGTAGTTCC

CRISPR22_I

4

38

29 bp


CRISPR809_II

6

12

36 bp

ACCTCAATGAAAGGCTGCGACCGAAGCCGCAGCGAC

CRISPR22_II

6

10

36 bp


CRISPR809_III

0

67

29 bp

CTTTTCTCCGCGTATGCGGAGGTAGTTCC

CRISPR22_III

0

32

29 bp


Trost et al. BMC Genomics 2011 12:383   doi:10.1186/1471-2164-12-383

Open Data