Table 2

New miRNAs and new members of known miRNA families with miRNA*s in M. truncatula

miRNAs

Sequence (5'-3')

Length (nt)

Counts of miRNAs/miRNA*s

Location

Arm

Length of precursors (nt)

MFE (kcal/mol)


miR5213

uacgugugucuucaccucugaa

22

15045/44

MtChr2:16737666:16737796:+

5'

131

-43.1

miR5274b

auaugacggaguguaaaugcc

21

29/2

MtChr4:11424365:11424459:-

5'

95

-66.3

miR5554a

ugugcaucuugaacaaugguau

22

134/3

MtChr1:31285750:31285854:-

5'

105

-52.8

miR5554b

ugugcaucuugaacaaugguau

22

134/3

MtChr4:41013393:41013497:-

5'

105

-57.3

miR5554c

ugugcaucuugaacaaugguau

22

134/1

MtChr7:19742691:19742795:-

5'

105

-53.3

miR5555

uaagaguauaauaugacuuug

21

40664

MtChr1:12905862:12905956:-

5'

95

-47.5

miR5556

ugaugacggaagaaauccaaa

21

155/1

MtChr4:23199944:23200064:-

3'

121

-54.8

miR5557

ugcuuccuuaguacuuguuga

21

5/3

MtChr5:6026167:6026481:+

3'

315

-96.7

miR5558

uuuuccaauucuaagucuauc

21

139/8

MtChr5:20521087:20521172:+

5'

86

-33

miR5559

uacuuggugaauuguuggauc

21

2124/2

MtChr6:937306:937443:+

5'

138

-48.8

miR5560

ugccggcucaaugaaugcggag

22

62/2

MtChr6:4747428:4747538:+

3'

111

-53.8

miR5561

cauuuggagagacauagacaa

21

449/3

MtChr7:30170572:30170660:-

5'

89

-42.9

miR5562

uguggagucuuuugcaugaag

21

16/1

MtChr7:32194444:32194667:-

5'

224

-56.4

miR5563

ugauaucaggcaacucggucc

21

12/1

MtChr8:32699524:32699624:-

5'

101

-52.9


miR156j

uugacagaagagggugagcaca

22

10341/23

MtChr1:3228429:3228554:+

5'

126

-44.4

miR167b

ugaagcugccagcaugaucug

21

40937/1

MtChr7:34009590:34009796:+

5'

207

-78.7

miR168c

ucgcuuggugcaggucgggaa

21

56024/1434

MtChr5:10397699:10397824:+

5'

126

-68.8

miR172b

agaaucuugaugaugcugcau

21

35344/63

AC235487:197944:198077:+

3'

134

-55.5

miR172c

agaaucuugaugaugcugcau

21

35386/8

AC233663:10168:10308:+

3'

141

-52.8

miR408

augcacugccucuucccuggc

21

75/55

MtChr1:21952074:21952198:+

3'

125

-45.1

miR2111u

uaaucugcauccugagguuua

21

413/23

MtChr7:14331003:14331117:-

5'

115

-50.2

miR2111v

uaaucugcauccugagguuua

21

1192/41

MtChr7:14356392:14356499:-

5'

108

-48.4

miR2592a

gaaaaacaugaaugucgagcg

21

28/1

MtChr1:27380857:27381050:+

3'

194

-89.4

miR2592bl

uggcaaguuugaauuuaccuca

22

43/1

MtChr4:18239825:18239954:+

5'

130

-69.3

miR2592bm

ggaaaacaugaaugucgggug

21

918/294

MtChr5:3041012:3041204:+

3'

193

-104.4

miR2592bn

ggaaaacaugaaugucgggug

21

530/160

MtChr5:8400182:8400375:+

3'

194

-111.8

miR2619b

auauguuuugauucuuuggca

21

9/3

MtChr4:6335670:6335840:+

5'

171

-94.7

miR2643b

uuugggaucagaaauuagaga

21

361/11

MtChr5:41836449:41836558:-

3'

110

-38.8

miR4414a

agcugcugacucguugguuca

21

663/45

MtChr1:30518803:30518924:+

5'

122

-50.5


Wang et al. BMC Genomics 2011 12:367   doi:10.1186/1471-2164-12-367

Open Data