Table 3

Primers used for PCR amplification and Sanger sequencing

Gene

Forward (5' to 3')

Reverse (5' to 3')


CSN3

AGAAATAATACCATTCTGCAT

GTTGTCTTCTTTGATGTCTCCTTAGAG

LEP

GATTCCGCCGCACCTCTC

CCTGTGCAAGGCTGCACAGCC

TICAM2

TCCTCTTCTGACTCGGATCTTT

CCAAGTTCTGTAAATGCTGTCTGC

TLR2-f1

TGGGTCTGGGCTGTCATCAT

AAGAGATGTTTCCCCAAGTGTTTT

TLR2-f2

GACCTGCAGAGGTGTGTGAA

TGAAAAATGGAAAGTGTGCAA

TLR4-f1

CGGGGAGAGACGACACTACA

TGTTTGCAAATGAACCTAACCA

TLR4-f2

TCTTTGCTCGTCCCAGTAGC

AAGTGAATGAAAAGGAGACCTCA

TLR4-f3

GGAGACCTAGATGACTGGGTTG

GGGGCATTTGATGTAGAACTTT


Cosart et al. BMC Genomics 2011 12:347   doi:10.1186/1471-2164-12-347

Open Data