Table 3

Details of the primers used for PCR amplification (A) Copy number and Relative expression studies by Real time PCR (B) in buffalo Bubalus bubalis

S.No.

Primer/Sequence ID

Forward

Reverse

Amplicon size (bp)

Annealing Temp (°C)

Nucleotide position of the primers in the sequence


(A) PCR Primers


1.

pDp1

TGCACTCAATATGCCAGAAAA

TGAAAGCAGTCTGTTGTTCCA

475

60

842-862

1296-1316


2.

pDp2

TGCAGCAATCACAATCCTTG

AACATCCTGGTTGCTTCCAA

124

60

66-85

170-189


3.

pDp3

TTGCACAGAATGAGCAGTGGT

GGCATTAATACTGGGATCAGG

101

60

492-512

572-592


4.

pDp4

GGACAGAAATGGTATGGACCT

TATATTGGAGAAGGCGATGGC

108

60

95-115

182-202


5.

BBACOT11(a)

GAGCCGGCTGTCAGAGTC

AGCCAGACAACCTGGAATGT

2504

60

34-51

2518-2537


6.

BBACOT11(b)

TGAAGCTGAAGCCAACTGTG

TCCTAAAAAGATCTTCATGACCA

2018

60

575-592

2570-2592


7.

BBACOT11g

AGTGAGGGGGTGTGCCCTGG

TGGTCGCACCCTCCTCGGAG

601

60

1-20

582-601


8.

β-Actin

CAGATCATGTTCGAGACCTTCAA

GATGATCTTGATCTTCATTGTGCTG

630

60

390-412

995-1019


9.

CD45

GACATCGCAGTGTTTGTTGC

GGAGGTTCACATTCCTCTCG

239

60

46-65

265-284


10

CDH1

TCTACAGCATCACTGGCCAACGAGCTG

TGCTTGGACCATCAGGGTGTATGTGGG

476

60

566-592

1015-1041


(B) Real Time PCR Primers


11.

Dp1

CCTGATGTTCAAGCTGGTTTTAGA

CAGAGGATGTTGGCAATTTGATC

65

60

1042-1065

1084-1106


12.

Dp2

GCAGCAATCACAATCCTTGGA

TGTAGGTTTCTGTGTGGGCATAA

63

60

67-87

107-129


13.

Dp3

CAAAGCAGTGCACAAGAATCAAT

TGCCTTGCCCAACCTTTTTA

63

60

318-340

361-380


14.

Dp4

AAGACCAGGGATCTCTTCAAGAAA

CGAGCTCATCTTTGCATGAAAT

66

60

24-47

68-89


15.

GAPDH

GCAAGTTCCACGGCACAGT

GATGGTGATGGCCTTTCCAT

68

60

227-245

275-294


Pathak and Ali BMC Genomics 2011 12:338   doi:10.1186/1471-2164-12-338

Open Data