Table 2

Oligos and genomic targets used in this study

Primer name

Forward (5'-3')

Reverse (5'-3')

gene target

gene target accession

Phenotype target


AB_UNI

CTTTCAGGKAGTATTGGTCT

CTCATTAGAGTTCACCGAAG

hypothethical protein

ACJ58112

all

AB_HYP

CGTCGGTCGGATCCGTGTAT

AAGTAAAGTGGCAGGCGCTT

hypothetical protein

ACJ57861

invasion

AB_INV

ATCCATTAGACCTCCCAATC

CATTGTTGATGTGAACTGGA

hypothetical protein

ACJ42779

invasion

AB_HEM

TCTCATCTAAAGCACCACCC

TAACCAGTGCTGGTGACATC

hemolysin

ZP_04662166

colonization

AB_COL

TCCAATGCCAAATCTTTACT

TGTGTTGAATAACCCTCAAA

alkyl sulfatase

ZP_04663686

colonization

AB_ALK

TTCCTGTTATAAGATTGGGAGAA

TTCTGATCCGAGTGATTTATTG

alkyl sulfatase

ZP_04663686

colonization

AB_INT

TATCCTTCAGCTTACCCTTCTT

TTTCGACATGTGGTAGACTGTT

Integrase

ZP_04661979

colonization

pOX

TGGCGATCAATTCTTACTTT

CGTAACGAAACGAAGTAATG

phenol hydroxylase

ZP_05824220

none


Sahl et al. BMC Genomics 2011 12:291   doi:10.1186/1471-2164-12-291

Open Data