Table 3

Name of the genes, primers used and expected size of the RT-PCR products for semi-quantitative RT-PCR

S.No

Gene Name

Forward primer

Reverse primer

Product size (bp)


1

Biotin carboxyl carrier protein I of ACCase (BCCP I)

GTCGGCTAATCTTAAAGCTATTC

TGTTTATAGCTTCACTAGTGTAC

258

2

Biotin carboxyl carrier protein II of ACCase (BCCP II)

GATGCTCTCATTGCAATTCTC

TAATGATAAATAACAATGAAGAAGG

278

3

3-keto acyl ACP Reductase (KAR)

GTTATCTCTCCCGAAAGTGTA

CACAGTATCTGTCACCTTTTC

306

4

Beta-keto acyl ACP synthase I (KASI)

GCATCTGGCTTGTCTCCAT

GCAGAAGAACACAATTTTGATAC

402

5

Acyl ACP thioesterase (FATA)

AATAATGTAGATTTCTTTATTTGTGT

AGTAAACGTAAAACAATACAGTTGAT

285

6

ω-3-fatty acid Desaturase (ω-3-FAD)

AAAGCTGCAAAATTTTTTATCTGCA

CCCTCTCAAATCCAATCCAA

215

7

Diacyl glycerol kinase (DGK)

CGGCTATTCGGTTGGAAATAA

GATTTTTGATACAACAAATTACCAGT

296

8

Delta12-fatty acid desaturase(Δ-12 FAD)

CTGATCAAAGCAGAGGTGTGT

CTCTGAATTTGAATTTTTATAAACC

301

9

Acyl-CoA thioesterase (ACT2)

CACGTGGTTTTGTATCTGGC

ACCCCGGCTGCTAGAATCAA

277

10

Stearoyl-ACP desaturase (SAD)

ATCCAATGTGCCATTCAGCTG

ACCTCCTGCTCGAGAATAGA

419

11

Pyruvate kinase(PK)

GTCTCATGACAGGGTAGTTGT

ACCTGCCTGCCATGGCATTC

264

12

Actin

CAAGTCATCACCATTGGAGCA

CCTTGGAAATCCACATCTGTT

342


Natarajan and Parani BMC Genomics 2011 12:191   doi:10.1186/1471-2164-12-191

Open Data