Table 6

Characteristics of "unique" nucleotide signatures for rrs sequences of 15 different Clostridium spp

Clostridium sp.

Signature


Nucleotide sequence (30 nts)

No.a

Frequencyb


C. beijerinckii

ATATCTAGAGTGCAGGAGAGCAAAGTAGAA

M10

23/23


C. sporogenes

AATCGCATGATTATCTTATCAAAGATTTAT

M1

11/11


C. butyricum

ACTTGACATCTCCTGAATTACTCTGTAATG

M3

32/32

TACAATGGTCGGTACAATGAGATGCAACCT

M9

32/32


C. colicanis

AAAGGGAGATTAATACCTCATAATATCCTA

M1

9/9

AAAACTTTAAAACCGGTCTCAGTTCGGATT

M3

9/9

ATACATGGATTAAAGGAGCAATCCGCTATA

M5

9/9

TAGGCGGATCTTTAAGTGGGATGTGAAATA

M9

9/9


C. kluyveri

AGATTAATACCGCATAGAAGGTAAAAATCG

M2

14/14

AGGCGGATATTTAAGTGAGATGTGAAAGAC

M4

14/14

AGTGCATTTCAAACTGGATATCTAGAGTGC

M5

14/14

AAATCTCAAAAACTGCCCCCAGTTCGGATT

M9

14/14

AAGAAGGTTTTCGGATCGTAAAGCTCTGTC

M10

14/14


C. pasteurianum

CGAAAGGGAGATTAATACCGCATAATATTA

M2

13/13

AAATGCGTAGAGATTAGGAAGAACATCAGT

M3

13/13

ATTGTAAAGCTCTGTCTTTTGGGACGATAA

M5

13/13

TAAACGATGAGTACTAGGTGTAGGAGGTAT

M7

13/13

TACAATGGTGAGAACAACGAGATGCAATAC

M8

13/13


C. perfringens

TTAGTTACTACCATTAAGTTGAGGACTCTA

M1

92/92

ACACTTGACATCCCTTGCATTACTCTTAAT

M2

92/92

TAGGCGGATGATTAAGTGGGATGTGAAATA

M3

92/92

AAGGTTTTCGGATCGTAAAGCTCTGTCTTT

M4

92/92

TTATGTGTAGGGCTACACACGTGCTACAAT

M5

92/92


C. chauvoei

AAAGGAAGATTAATACCGCATAATATTGCA

M1

8/8

AGACTTGACATCTCCTGCATTACTCTTAAT

M3

8/8

AGTAATTAAAGGAGCAATCCGCTACAAGAT

M4

8/8

TAAACTATAATACTTGTCTCAGTTCGGATT

M5

8/8

AACTTGGGTGCTGCATTTCAAACTGGAAGT

M8

8/8

AAGGTTTTCGGATCGTAAAGCTCTGTCTTC

M9

8/8


C. tetani

AACCCTTATTATTAGTTGCTACCATTAAGT

M1

8/8

TTAAGTGAGATGTGAAATACCTAAGCTTAA

M2

8/8

AAAGGAGGATTAATACCGCATAAAGTTAAG

M3

8/8

TTTAACCAAAGGAGTAATCTGCTTTGAGAT

M4

8/8

AGTTGCTAGTAATCGCAAATCAGAATGTTG

M5

8/8

TTCTGTGCCGCAGTTAACACATTAAGTATT

M6

8/8

AAATCTCAAAAACCGATCCCAGTTCGGATT

M7

8/8

AAGGTTTTCGGATCGTAAAACCCTGTTTTC

M8

8/8

ACGGTCGCAAGACTAAAACTCAAAGGAATT

M9

8/8


C. baratiic

TTGTAAAGCTCTGTCTTTGGGGACGATAAT

M3

8/8

ATTTTTAAGTGGGATGTGAAATACCCGGGC

M6

8/8


C. sardiniensec

AAAGGAAGATTAATACCGCATAACATTGCA

M1

9/9

TAAACTTCAAAACTTGTCTCAGTTCGGATT

M2

9/9

TTCGCATGAAACAGCAATTAAAGGAGCAAT

M4

9/9

CTACAATGGCAAGTACAGAGAGATGCAATA

M9

9/9

GTAAACGATGAATACTAGGTGTAGGGGTTT

M10

9/9


C. botulinum

(CBoI - 83/128) c,d

AAAACTTATAAAACCTATCTCAGTTCGGAT

M1

82/83

AACCCTTGTTATTAGTTGCTACCATTAAGT

M2

83/83

AAGGTCTTCGGATTGTAAAGCCCTGTTTTC

M7

83/83

GTAGGCGGATGTTTAAGTGGGATGTGAAAT

TAAACGATGGATACTAGGTGTAGGGGGTAT

M8

M9

83/83

82/83


C. novyic

AAAGGGAGATTAATACCGCATAACATTATT

M1

17/17

AAGATTAAAACTCAAAGGAATTGACGGGGA

M3

17/17

ACTTTCTGGACTGTAACTGACACTGAGATA

M6

17/17

TTAAGTCAGATGTGAAATTCCCGGGCTTAA

M10

17/17


C. subterminalec

AATGAAGAAGGCCTTAGGGTTGTAAAGTTC

M6

8/8


C. acetobutylicum

No unique signature could be found

-

24/24


aRefer to Additional file 8: Figures S20-S36 and Additional file 9: Tables S5-S20

bFrequency of occurrence of the signature out of the total sequences screened.

cCan be designated as unique signatures if we assume i) C. baratii and C. sardiniense and ii) C. botulinum, C. novyi and C. subterminale to belong to single sp. based on phylogenetic framework and in silico analyses

dOut of the two groups of 45 and 83 organisms, no unique signature could be detected in the first group

Kalia et al. BMC Genomics 2011 12:18   doi:10.1186/1471-2164-12-18

Open Data