Table 4

Sequences and GenBank accession numbers of re-designed primers used for qPCR analysis during experiment 4.

Gene

Forward 5'-3'

Reverse 5'-3'

Product size (bp)

GenBank


ANXA1

ATGGTATCTGAATTCCTCAAGCAG

TGCAAGGCCTCAACATCC

149

NM_175784

H2AFZ

CGGAAAGGCCAAGACAAAG

CTGAAATCTAGGACGACTAGCCAT

103

NM_174809

Luciferase

TCCTCCAGGGATACGACAAG

GGTATCCAGATCCACAACCTTC

139

EU684088

LUM

CGAAAGCAGGGTCAAGACAG

TGATGACCTCCCATACAGTGC

158

NM_173934

MAOA

TGGCGGACCATGGATAAC

AAACTGCCGAGCAGTCTTTG

138

NM_181014

PLAT

TGTGGAGCTGTCTTCACGTC

CGTGTTGGCGGTACGTC

118

NM_174146

PLAU

CTGTGCCCTGGTCGTGAG

GCAACTGCATCGCTGAATG

136

XM_174147

PPIA

CCACCGTGTTCTTCGACATC

CCAAATCCTTTCTCTCCAGTGC

130

NM_178320

SDHA

GGGAGGACTTCAAGGAGAGG

TCAACGTAGGAGAGCGTGTG

112

NM_174178

SERPINE1

CAGGCGGACTTCTCCAGTT

CATTCGGGCTGAGACTACAAG

135

NM_174137

STC1

GTGACACAGATGGGATGTACGAC

CGAATGGCCAGGAAGACC

142

NM_176669

TGFB2

AGGCCGAGTTCAGAGTCTTTC

TGTAGCGCTGGGTTGGAG

117

NM_001113252

YWHAZ

GCAGATGGCTCGAGAATACAG

GAAGCGTTGGGGATCAAG

102

NM_174814


Mamo et al. BMC Genomics 2011 12:151   doi:10.1186/1471-2164-12-151

Open Data