Table 1

Primer sequences and amplicon length

Gene

Forward Sequence

Reverse Sequence

ALa (bp)


GAPDHb

GGGTCATCATCTCTGCACCT

GGTCATAAGTCCCTCCACGA

176

GAPDH

ACCCAGAAGACTGTGGATGG

CAACAGACACGTTGGGAGTG

178

ACTB

GACATCCGCAAGGACCTCTA

ACATCTGCTGGAAGGTGGAC

205

MUC1

CACTGCTGCCAGCCATATTA

TCAAACCCCAAATGCTTCTC

212

MUC2

CATGTGGAACCAGGAGGACT

ATGTTCCCAACCTCGACAGG

153

MUC3A

CCGTCACAAGTACATCTAACACAG

ACATATTCGAGGCGTTAGCA

150

MUC4

GGAGAGTGCAGAGTCCTTGG

AGCAGCAAAGCCAATGAAGT

323

MUC5AC

CAGACCCTCCACCTTCTTCA

GGTCCTCGAAGCTGTTCTTG

263

MUC5B

TCTACCTGACCGTGGAGACC

GTTGATGATGCTGCACTGCT

299

MUC6-1

CAGCAAGGACAAAATCGTGA

CTCTGGTCTGGCCTCTGAAC

218

MUC6-2

CACGGCCTCCTGTCTTCTAC

AGAAGATGGACTGGCTCTCA

190

MUC7

TCCTGCTCCTAAGGCTACCA

GTGGAGGGGAGTGGTACTGA

155

MUC12

TACAGGGGCAACAACTTTCC

CGTCTCATCGTAGCACAGGA

234

MUC13

ACCTGGGACAGAGACACCAC

GATTGTCGGGGTAGGAGACA

262

MUC15

CTGCCTTGGAACTCATCCAT

CACAGACGTGGTGTTTGGTC

183

MUC16

TTCAGAAACAGCAGCATTGG

GTGTAGTGGTCCAGCCGAGT

200

MUC19

TTCTGGAGGGGCTGAATATG

CTCTCGTCCACCAAAAGAGC

204

MUC20

GGACATCACTGCTCTGACGA

GGGCTATTGTCCAGGTCTCA

239

MUC21

CAACCACAGGAGGCTCTGAT

CAAAGAATCCCACGACCACT

173

BSM

GGAGACATATGGACTGCCAAT

CACAGTATGCAATTTCACAGCA

194


aAL: cDNA amplicon length

bGAPDH intron-spanning primers, used to investigate gDNA contamination

Hoorens et al. BMC Genomics 2011 12:140   doi:10.1186/1471-2164-12-140

Open Data