Table 3

Oligonucleotides used in the study

Locus tag

Forward primer (5'-3')

Reverse primer (5'-3')


A1S_r01*+

CAGCTCGTGTCGTGAGATGT

CGTAAGGGCCATGATGACTT

A1S_2501+

CAACACTGGTAAATGGCGTG

ACAACGTTTTTCATTTCGCC

A1S_0395

TCATGCTCTTGTTCAGTGGC

GCATTGCCAATACCCCTAGA

A1S_3420

GCCTTGCTTTACTTGTTCCG

GCATCAGTAAATGGGCAGGT

A1S_2562

TTGCCATCAGTAGTGCAACC

TCCTGCAATCACAACACCAT

A1S_3371

CAGATCCAACTGTGGTGGTG

TCAGCATCGGTACGGTTACA

A1S_0895

GCGCAAAGCTGGACTTAAAG

CGGTAAACTGTCGCAAGTCC

A1S_2565

TGGCTCGATATTCAACGTCA

TAACAGCAAACCACCACCAA

A1S_0897

CCGCGAGCGACTAAGC

TGTCGCAGCCCATGAA

A1S_1647

GGACGCCATCGTCTCG

GCGTCCCGGCTTTGTA

A1S_1925

GGTGGCGCGCTATTTG

GTTGCGCCATTGGGTA

A1S_2080

GGTCGATGGCGTTCCA

CAGCCGCTTTCGTGGT

A1S_3195

GCGCTCAACCGCGTAA

TGCCGGATCGTCTTGC

A1S_1509

CCAAGGAAGGCGCTGT

TTGGGGAATGGCTTGC

ABAYE1887

CCCTTTTGATGATTTTACGG

CAAGGCTTAAGCGCGGTA

ABAYE1888

CCAGCGCATCACCACA

TCCGCTCGAACAACTCA

ABAYE1889

GGGGCGATTTCAAGTGC

TCGCGATCAGCCAACA


* Primer sequences obtained from Higgins et al., 2004 [66].

+ Oligonucluotides used as references.

Eijkelkamp et al. BMC Genomics 2011 12:126   doi:10.1186/1471-2164-12-126

Open Data