Table 1

Putative FUR binding sequences in the ATCC 17978 genome

Locus tag

Putative FUR binding sequence (5'-3')


A1S_0242

TTATTTGGTAATTATTCTCATTTAT

A1S_0416

GGATTTGTTAATGATTATCATTTGC

A1S_0474

GCGAATAATAATAATTCTTATTTAT

A1S_0980

GATATTGTTAATAATTATCATTATT

A1S_1647

TGAAATGATAATAATTATCATTAAT

A1S_1657

ATAATTGATAATGATAATCATTTTT

A1S_1667

GATAATGTAAATAATTCTCATTTAT

A1S_2077

TCATTTGATACTGATTATCAATATT

A1S_2080

ATAAATGAGAATGATTTTAATTAAT

A1S_2123

GATAATAAGAATTATTTTTATTTGT

A1S_2278

TTATTTGATAATGATTTTCATTTAT

A1S_2372

GTTATTGATAATAATAATCATTTGC

A1S_2382

GCAACTGGTAATCATTTTCATTTGT

A1S_2391

GTAATTGTAAATGATTATCATTTAT

A1S_2392

GTAAATAATAATCATTATTAATTGT

A1S_2567

TTACTTGAGAATGATTCTTGATAAC

A1S_2581

TTAAATGAGAATCATTTTCATTTAT

A1S_2582

TTAAATGAGAATCATTTTCATTTAT

A1S_2667

TTTTTTGAGAATTATTATTGATTAT

A1S_3174

ATTATTGATAATTATTATCGTTTGT

A1S_3324

GATAATGAGAATTATTTTAATTTAT

A1S_3339

TTAAATGATTATAATTATCATTTAT


Eijkelkamp et al. BMC Genomics 2011 12:126   doi:10.1186/1471-2164-12-126

Open Data