Table 2

Sequences of primers used in this study

Primer Name

Primer Sequence (5'-3')


05060_PL

TCAAACCACGTCAGCTTCAC

05060_PR

CTTGTCCACCACTTCTGCAA

05060_PS

TAAAATCATTTTATACTCTTCGAAAATCTC

16220_PL

ACCTGATAAAATTTCAGTAAAATGC

16220_PR

TGTAAACGAGTAAAAGCGAAT

17630_PL

GAAGCCAAAACCTTCATCCA

17630_PR

CAGGCTGCTCAAAACACG

17630_PS

TTCACCTTTTGTGGATTGGTC

21390_PL

TGTTCATATTCTAGGAAGATTTGTTGA

21390_PR

GCAGGTTGCTCAAAACACTG

21390_PS

TCCATAATATCTATAGTGGATTTACCC

Tbox_PL

AATCTGCAATCGCAGCTAGG

Tbox_PR

CGTTACCAACGCCCTCAC


Croucher et al. BMC Genomics 2011 12:120   doi:10.1186/1471-2164-12-120

Open Data