Table 8

Primers for the real-time RT-PCR experiment. Sequences of the forward and reverse primers of the differentially expressed and housekeeping genes for the real-time RT-PCR experiment.

Accession ID

Gene Symbol

Direction

Primer Sequence


House Keeping Gene


Mm.180458

Rpl13a

Forward

5' GAGAAACGGAAGGAAAAGGCC


Mm.180458

Rpl13a

Reverse

5' GCAGGCATGAGGCAAACAGT


Differentially Expressed Genes


Mm.127058

Stard4

Forward

5' GAGTGGCGAGTTGCCAAAAA


Mm.127058

Stard4

Reverse

5' CCACGTCATCCATAACTCCTTGA


Mm.1192

Igj

Forward

5' TCATCCCTTCCACCGAGGA


Mm.1192

Igj

Reverse

5' CCAGCTCCACTTCCACAGGA


Mm.8245

Timp1

Forward

5' AAATGCCGCAGATATCCGGT


Mm.8245

Timp1

Reverse

5' CTGATGTGCAAATTTCCGTTCC


Mm.1355

Cd79a

Forward

5' ACAGGCCAGCTGTTCTTCCC


Mm.1355

Cd79a

Reverse

5' GCTGTGATGATGCGGTTCTTG


Mm.263396

Itgb1

Forward

5' CCAGTCCCAAGTGCCATGAG


Mm.263396

Itgb1

Reverse

5' GCAGTAAGCGTCCATGTCTTCAC


Mm.286622

Pex13

Forward

5' GTGGCCTGCCTTAGTGCTGA


Mm.286622

Pex13

Reverse

5' CGTGGTCATCCTCACCACTTG


Mm.233846

Syt4

Forward

5' CTTATCCCCACATCCAAGAGCTC


Mm.233846

Syt4

Reverse

5' AGACCAGAAGTTCACCCCGG


Husain et al. BMC Genomics 2011 12:12   doi:10.1186/1471-2164-12-12

Open Data