Table 1

Primers used for amplification of SPC-P1

primers

sequences

Site at SPC-P1

Product size (bp)


1 s

5'TTACTCCGCTGTTTCTTCTTCGTCTTCTTT 3'

407

6876

1 r

5'GGGATGGTGTGGGCTATGGTGCTTGCTTATGT 3'

7282

2 s

5'ATCGTCTAGGCGTTTCATGATTGCTCTGTTCGTG 3'

7217

5910

2 r

5'GTTATGGTATTCAAACTCAATCCACTGTTGCTTA 3'

13126

3 s

:5'GCGGCAAGGTGTGGAATGGAGAGCGAGAACTGGA 3'

12813

6228

3 r

5'ATTTTCCTTTGACGAGCACCCGACCACCATTATC 3'

19040

4 s

5'GGAACGGTCAGAGAGATTGAGGTATGAGCAGAGT 3'

18726

7039

4 r

5'TTTTGGCATGATTCTGGCCTTCGATTCGATACGT 3'

25764

5 s

5'AGCAACGCATGGCTAAGTGGGCAGAGGATAACGG 3'

25409

6671

5 r

5'TTAGCCGCATCAGAGCCAGGAACTGTCGGAAACG 3'

32079

6 s

5'TCCGCAGCAATCAGGCAGGAGAAGCACTAACAGC 3'

31704

6731

6 r

5'ATGCAGCTGGCACACGTAAGCGGCGGGAC 3'

38434


Zou et al. BMC Genomics 2010 11:729   doi:10.1186/1471-2164-11-729

Open Data