Table 4

Sequences of primers used for the validation of microarray data by RT-PCR

Gene Name

GenBank Accession

Forward Primer Sequence

Reverse Primer Sequence


RPL41

NM_021104

AAGATGAGGCAGAGGTCCAA

TCCAGAATGTCACAGGTCCA

LOXL2

NM_002318

AGCTTCTGCTTGGAGGACACA

TGAAGGAACCACCTATGTGGCA

ANGPTL4

NM_139314

GTCCTCGCACCTGGAACCC

CTTCGGGCAGGCTTGGCCAC

PFKFB4

NM_004567

TCCCCACGGGAATTGACAC

GAGAGTTGGGCAGTTGGTCAT

BNIP3

NM_004052

ACACCACAAGATACCAACAGG

TCTTCATGACGCTCGTGTTCCTC

GAPDH

NM_002046

AGGCTGAGAACGGGAAGC

AGAGGGGGCAGAGATGATG

CA9

NM_001216

AACCAGACAGTGATGCTGAGT

TGGCATAATGAGCAGGACAGGA

MAL

NM_002371

AAACATTGCTGCCGTGGTGTTC

AGGTTAGACACAGCAAGCTCCCA

OLFM4

NM_006418

ATTGGGTGGCGCCATTGAATA

TGGTGTTCATAGTACGGGTGGCA

ID2

NM_002166

GACCCGATGAGCCTGCTATAC

AATAGTGGGATGCGAGTCCAG

DSG4

NM_177986

TGAAGATGAAGGTCGACCAGC

GGGTTGCACACATGGATCAGCAT

KRT1

NM_006121

AGAATGCCCTCAAGGATGCCA

TTCTCCGGTAAGGCTGGGACAAA

MMP1

NM_002421

AAGAGGCTGGGAAGCCATCAC

TCAGTGAGGACAAACTGAGCCA


Busch et al. BMC Genomics 2010 11:65   doi:10.1186/1471-2164-11-65

Open Data