Table 5

Oligonucleotides used in this study

Oligonucleotide

Sequence (5' to 3' direction)a

Use


3' adapter

P--rUrUrUCGGGCCGCGGACTGTidT

cDNA cloning and RACE

5' adapter

GATATGCGCGAATTCCTGTAGAACGAACACTAGGGGrArArA

cDNA cloning and RACE

5'PRIMER

GTAGAACGAACACTAGGGGAAA

cDNA cloning and RACE

3'PRIMER

GACAGTCCGCGGCCCGAAA

cDNA cloning and RACE

3' adapter_B

P-rUrUrUCTATCCATGGACTGTidT

cDNA cloning tmRNA

5' adapter_B

GATATGCGCGAATTCCTGTAGAACGAACACTAGAAGrArArA

cDNA cloning tmRNA

5'PRIMER_B

GTAGAACGAACACTAGAAGAAA

cDNA cloning tmRNA

3'PRIMER_B

TACAGTCCATGGATAGAAA

cDNA cloning tmRNA

ftrA_GSP_5'RACE

GTTATTCAGACGTGTCAAACAGAG

5'-RACE ftrA

ftrA_GSP_3'RACE

GTACCAAATAATTAATGCTCTGTAATC

3'-RACE ftrA

ftrB_GSP_5'RACE

GAGATTCCCGCCTACGCGG

5'-RACE ftrB

ftrB_GSP_3'RACE

GATACTAACTTAACGTCGGTAGTC

3' RACE ftrB

ftrA_DelR

GC

    GCGGCCGC
GTGGTAAAATCATCTAGGTTCTAGC

Deletion ftrA

ftrA_DelB

CATTTATAATTTTAGATATTTTTTCGC

Deletion ftrA

ftrA_DelO

GCGAAAAAATATCTAAAATTATAAAT

    G
GGCAATTAATATATCTTGTTCGCTTCTTAGC

Deletion ftrA

ftrA_DelT

GCGTCGACGCAACTAAGAAAAGAATATTTAATAGCC

Deletion ftrA

ftrA_DelCheck1

CATATGTAGTGTACTTTATTTAAATAC

Verification of ftrA deletion

ftrA_DelCheck2

CCTAAGTTTCAGTTGCTGAATTATTTGG

Verification of ftrA deletion

ftrA_DelCheck3

GCCACTGAAGGCGGAAATCTCGC

Verification of ftrA deletion

ftrA_DelCheck4

CAGTTAAATATTATTAACATTAAGAAAC

Verification of ftrA deletion

ftrB_DelR

GC

    GCGGCCGC
CTTTTAAGATTTGTATTCTTATTTGTTC

Deletion ftrB

ftrB_DelB

CACTACCCCGTATTGCTTCGCAAGCC

Deletion ftrB

ftrB_DelO

GGCTTGCGAAGCAATACGGGGTAGTGCCTAAGGAGTCAAACTAACAAAGGGGCCTGC

Deletion ftrB

ftrB_DelT

GCGTCGACCAGAGCATTTATGATAGTTTGTTTTCC

Deletion ftrB

ftrB_DelCheck1

CTAAATCTAAGGAATGATAATTAACC

Verification of ftrB deletion

ftrB_DelCheck2

GGACAGGAATGGACAGCAGAAG

Verification of ftrB deletion

ftrB_DelCheck3

GTATATCCTATTTGAAAAGCTAATGGC

Verification of ftrB deletion

ftrB_DelCheck4

CACTATATGGATATGCTTATGAACAAGC

Verification of ftrB deletion

ProbeA

CAGACGTGTCAAACAGAGGTCCGTTCAAAATAC

Northern blot

ProbeB

GAGATTCCCGCCTACGCGGGAATGACTACCGACG

Northern blot

FTL_0044_F

GCTATATGTCCCAGGTGTAAGG

qRT-PCR

FTL_0044_R

GCTCTTTGGCTTTTTTAGGGGTC

qRT-PCR

FTL_0421_F

GGGCAACTGTAACAGTTAAGC

qRT-PCR

FTL_0421_R

CTTCTTTGTCATAAACTACATTAGC

qRT-PCR

FTL_0836_F

GTGGCTATTGATGACATACTCAAC

qRT-PCR

FTL_0836_R

GCTAAGCCTAGATAACTGATACC

qRT-PCR

FTL_1922_F

GGATTTGATTTTTCTCCAATTATTG

qRT-PCR

FTL_1922_R

CTGCGCAATAATGCTTTGTATG

qRT-PCR


a Bases preceded by r designates a ribonucleotide whereas all other are deoxyribonucleotides. idT designates an inverted deoxythymidine. P designates a phosphorylated 5' end. NotI site is underlined. SalI site is shown in italics.

Postic et al. BMC Genomics 2010 11:625   doi:10.1186/1471-2164-11-625

Open Data