Table 5

Primer sequences used in qRT-PCR

Probe ID

Gene Name

NCBI accession no.

Forward primer (5'->3')

Reverse primer (5->3')


Bt.5323.1.S1_at

SH3 domain YSC-like 1 (SH3YL1)

CB535095

ACCAACCCATAGAAGTGACAGCAC

CGAAGCTTTCCTTCCCACCAATCA

Bt.15675.1.S1_at

ADAM metallopeptidase with thrombospondin motif 4 (ADAMTS4)

NM_181667

AGTTCGACAAGTGCATGGTGTGTG

TGGTGACCACGTTGTTGTATCCGT

Bt.21021.1.S1_at

TBC1 domain family, member 7 (TBC1D7)

CB451394

CTTCGTGAACCAGCTGAACAGCAA

CGGCAAAGCACTTCTTGAACCACA

Bt.2933.1.S1_at

Hypothetical protein LOC788205

CK972377

GCCAAAGCAGCTGTCGGTAATGAA

TCCATCACACCGCGAAGACTCTAA

Bt.9767.1.S1_a_at

Squalene epoxidase (SQLE)

CK949309

AGTAATCATCGTGGGATCTGGCGT

ACCTGGGCATCAATACCTTCCACT

Bt.621.1.S1_at

Cytochrome P450, family 51, subfamily A (CYP51A)

BE664559

GTATGACCTCAACAACCCTGCCAA

TGACCACGACGATGATGAAGACCA

Bt.23903.1.A1_at

Unknown

BP102962

ACACAGGCCGTGCAAACTAAACAC

TCTTGATTTGCTGCTGGGACCTCT

Bt.22362.1.S1_at

SH3-domain kinase binding protein 1 (SH3KBP1)

CK774919

TGAGGGATGCACAGATGAGTGTGA

TTGAAGGCTGGAGGGCACATCTTT

Bt.16752.1.A1_at

ATP binding protein (TXNDC9)

CB536841

TTCATCTGCTGATGGCCACACTC

AGAGAATCCAGACTCTCCTCAGA

Bt.1020.1.S1_at

CDC-like kinase 1 (CDClk1)

CK848317

TTTAGGATGGTCCCAGCCATGTGA

GCCCAAGAATCCTTTCCATCATTGCC

Bt.19107.2.A1_at

Transcribed locus

BE723026

CCATGAGAACTGACTCGGGAGTTT

CAGGCTGTCTGGCAAGCAACAATA

Bt.28011.1.S1_at

Unknown

CK940528

AGGAAGAACCTTCTGTCCCAGCTT

TTGAGACTTCCCAGGTCAAAGGCA

Bt.22718.1.A1_at

Proteasome (prosome, macropain) activator subunit 4

CK945034

GCTGAGGTGTGGGTTTGTTTGAGT

AAACTGGTCACAGGCAAACACG

Bt.19107.1.S1_at

Transcribed locus

BE723026

GACCCAAGAGTTGCTTAAGAGAGC

ACCCTCAGTCCACAGATGATCAAG

Bt.25102.1.S1_a_at

Hypothetical LOC509649

CK772143

TTCCTCCCACTGGTGAGCATCTTT

TGTGTTGCTCAGTGTTCTCCTCCA

Bt.22038.1.S1_a_at

Arginyl-tRNAsynthetase (RARs)

CK947459

TTGAAGGCTGCTCAGACCTCTGTT

TAAGCCGCTGTGTTTCCTCTGTCA

Bt.21268.1.S2_at

Ribosomal protein S6 kinase, 70kDa (TUBD1)

CK977623

CGTGACTGTAGATGGTGAAAGGGT

TGCACACTCAGACTGAAGACAC

Bt.13342.1.S1_at

Src-associated protein SAW (UTP15)

BM030756

CTCATAGCCATCAATAGTTCAGTGC

TCAAGTAGCAAATACTACAGTTTGTC

Bt.344.1.S1_at

Major histocompatibility complex, class II

D76416.1

TCACACCAGCACCCTCTGATCTTT

TAAGCACGGCTTTCGGCAGTAGAA

Bt.21827.2.S1_at

Thimetoligopeptidase 1 (THOP1)

CB444022

AAGGTCTCCATCTGGAGGTGTTTG

AACTCCCAGGAAAGGGCTGCATT

Bt.21794.1.S1_at

Hypothetical protein LOC777601

CA034934

CATGAGACACAGGCGAAACACTGA

TCTTTGGGAGAAAGGGAAACTGGG

G3PDH

Glyceride 3 phosphatate dehydrogenase

AY779626

GGGTCATCATCTCTGCACCT

GGTCATAAGTCCCTCCACGA

IL17A

Interleukin 17A

CB432107

TCATCATCCCACAGAGTCCA

GGAGAGTCCAAGGTGAGGTG

TNFα

Tumor necrosis factor

CK848164

GGCCATGGTATTGACATCCT

GGATCTTCTCCACCACATCG

TGFβ1

Transforming growth factor beta 1

CK772652

ACTACATCTCGGCGCTCAGT

GAAGGTGCAGGTGAAGTGGT


Lee et al. BMC Genomics 2010 11:623   doi:10.1186/1471-2164-11-623

Open Data