Table 4

Forward and reverse primer sequences used in semi quantitative RT-PCR analyses.

Candidate gene

GenBank acc. no

5'-3' forward primer

5'-3' reverse primer


RECOGNITION

Galectin

HM756110

CTCCGGCGGGAGGGAATCCA

AGTGGAAGCTGGGGTTCCGAGG

Carcinolectin

HM756111

CGGATACAGTGGCACGGCAG

TGATACCAACGAGCACCAGCAC

Aggrecan

HM756112

TGCAAGCGGATACCCGGTAAA

ATCAACGCAGAGTGGCCGAG

C-lectin

HM756113

AGGCTTGGGATAGGCACATGGA

ACGATTCACCCGAACAGAGTTGG

LBP/BPI

HM756114

GCTTCACTGATACTGCTTGCCC

CCACGGTGGAGCAGCATGGA

SRCR

HM756115

TGATTCGATACCAAGGACCCAAAGGT

TGTCAACTCCGGCTATTCCAGGT

PGRP

HM756116

TCACACGGAAGGAGGAGCGT

AGGGCTGCCTTGGATGGTGT

Thrombospondin

HM756117

TGCTGCGACCCATTTCTGTGA

GTGAGGAGTTCCACTGGTGAGGG

Rhamnose-binding lectin

HM756118

ACAATGGGTTGATTTGTTTGCCGA

CCGGGGGCCTGAAAGTTGGT

SIGNALING

Lipoprotein receptor

HM756119

CAGAGCCATCCACTTTGGCGG

AGGTCTACACCTTCCAGCAGCA

Integrin

HM756120

ACGGCCGGGGAGAAGTTGAA

CGCAGTCACACGTTCCACAGAC

Serpin

HM756121

AGGGTTGTGCGTGAAGTGGA

TCTCAAAGCGAGGCTGCCAGA

α-macroglobulin receptor

HM756122

CATTACGGCCGGGGCAAAGG

TGCTGGCTCTCTCAGCTCGG

Tenascin

HM756123

CATTACGGCCGGGGGTTGTA

AGTCGGAACAGTCCTTTGGGT

EGF

HM756124

GGGACACATTGCGAAACGGC

TTGCCCCGTAAATCCAGGCA

GTPase

HM756125

ATTACGGCCGGGGGACACAC

TTCGGCATCCTGGCACTTCG

TNF factor

HM756126

GGGATTAGGCAACACCCAAGCC

CCGCCACAGTACAGCCAACC

VEGF receptor

HM756127

AGCTGCATGGAGACTTGAACCAGA

AGGTGGGGTGGTACTTGCTCC

Fas ligand

HM756128

CGATTCGCTAGGACCGGGGA

AGTCATTGGCGGTACTCCACACA

Toll

HM756129

AGGAGGACTCGGATGACACAGC

ACTCCGGAACTTGGAGAGCACG

MyD88

HM756130

CTGCCACACCCAACAACGCA

TCGAGACTGAGGTTCTCGCACA

TRAF

HM756132

CCCAACGACAGCCTTCTTTGACG

ATTACGGCCGGGGGCTTGTT

IRAK

HM756133

GAGTGGCCATTACGGCCGGG

GCTTGCATCGATCTGGCGGGT

TRAF 6

HM756134

CACCTATTTCCGCTTCCCGCC

TGGAGGGTGGTGGTGCTCTT

TRANSCRIPTION

NF-κB

HM756136

CCAAATGATGCACCTGCTCTTTTCAGT

CATTACGGCCGGGGAAGGGA

Tal

HM756137

GTTGACGCCATCGCTCTCGG

GCCATTACGGCCGGGGTTTA

Jun

HM756138

CGCCAACACCGACACAGTTCA

AACCCCCGGGGAGTGTTGTT

AP-1

HM756139

TGCAGCTACACGGTTTCTGGC

TCGGCAACAACACTCCCC

I-κB

HM756140

TGAGGCAGCACTGAACGGAC

CGCAGAGTGTGCCAACAGCA

STAT long form

HM756141

ACGGCCGGGGTAAAGCTGAA

ACAAATCCAGCCACATGCCCA

STAT (SH2 motif)

HM756142

AGCGTCAAACACGACAGACGA

AGACCACGCCCTGTTTCAGC

EFFECTOR

Cytolysin

HM756143

CGGTTGCTGTGTAGCCGCAT

GGCGTCCAGAGACCGGAGTT

Glutathione peroxidase

HM756144

TTAACGGCGTCGTCGCTTGG

TGGCTTCTCTCTGAGGAACAACTG

TIMP

HM756145

TGTCCCATGGGTCTGGAACGG

TCAGCCTGTTCCTCTTGGCATT

Thiolester- macroglobulin

HM756146

CTGGCTCTCTCAGCTCGGCA

GGGCACTCTCCGGTCTTGGT

Metallothionein 1B

HM756147

TCGGCACTGTCCACACAAAACC

CAACCGGAAGCGGATGTGGC

Big Defensin

HM756148

CCGGGGGCGATTGCCTTTC

ACCAAGGCCCAAAATGCAGC

Defensin

HM756149

AACGCAGAGTGGGCCATACG

TCACTGGTGCGAACCGTTTGT

Ferritin

HM756151

TCAACGCAGAGTGGGGCCAT

GCGGTTCAGAAGTTGTTGTCACG

Catalase

HM756152

CATGTTAGCAGGCACTCCAGACC

TACGGCCGGGGGAAAAAGGT


Based on sequences retrieved from the DeepSeaVent database, primers were designed to confirm, in RT-PCR experiments, the physical counterpart of B. azoricus genes putatively associated with immunity and inflammatory reactions.

Bettencourt et al. BMC Genomics 2010 11:559   doi:10.1186/1471-2164-11-559

Open Data