Table 2

Top 20 novel abundantly-expressed miRNAs in S. japonicum

MicroRNA Name

Mature Arm

miR*a

Most abundant sequence

Len

Expressionc (TPMb)

AduMix

schistosomulum

P-valued


Sja-Novel-16

5'

Y

UGAUAUGUAUGGGUUACUUGGU

22

16802

1405

0

Sja-Novel-137

5'

Y

AGAGGUAGUGAUUCAUAUGACU

22

8800

3484

0

Sja-Novel-110

3'

Y

UGAGAUCGCGAUUAAAGCU

19

6477

6

0

Sja-Novel-148

5'

Y

UCCCUGAGACUGAUAAUUGCU

21

4888

909

0

Sja-Novel-70

5'

Y

UCAGCUGUGUUCAUGUCUUCGA

22

843

1

0

Sja-Novel-168

3'

Y

UAUUAUGCAACGUUUCACUCU

21

164

439

0

Sja-Novel-166

3'

Y

UGAGAUUCAAUUACUUCAACU

21

345

8

0

Sja-Novel-37

3'

Y

UAUUGCACUUACCUUCGCCUUG

22

169

57

0

Sja-Novel-173

5'

N

CAGACUCACAGAAAUGCUAA

20

31

29

0.159

Sja-Novel-245

5'

Y

UCUUUGGUUAUCAAGCAAUAUGA

23

46

10

0

Sja-Novel-239

3'

N

CUGAGAAUCUGUUGGAUGUU

20

23

27

0.001

Sja-Novel-255

3'

N

GGCGGAUAGGGAGUUGGCGU

20

35

13

0

Sja-Novel-120

3'

N

ACGAGGGCGCUGCAGGGGUUUU

22

24

2

0

Sja-Novel-121

3'

N

GCCAAGACGCGUCACGACAUUU

22

20

4

0

Sja-Novel-35

5'

N

UGGACACAGUAGCCUAGUGGUU

22

16

7

0.0008

Sja-Novel-36

3'

Y

UAUCACAGUCCAAGCUUUGGUAA

23

10

13

0.0054

Sja-Novel-147

5'

N

UGGCAAGAUUACGGCGAAGCU

21

18

4

0

Sja-Novel-128

5'

N

AAGCGUUCGGACGUUGGCAC

20

19

1

0

Sja-Novel-203

5'

N

AGUUAUAUUUAAGUUGGAUUUU

22

8

12

0.0012

Sja-Novel-21

5'

Y

AAGUUCUGAUAGAUGUUGCA

20

16

4

0


aY indicates that the sequences from both strands of a miRNA* species were found, while N means that only the sequence from one strand of a miRNA* was identified.

bThe abundance value of each miRNA was normalized to "transcripts per million (TPM)". If the value after normalization was less than 1, the normalized value was set as 1.

cThe expression of miRNA was the sum of the total counts of unique reads which was within ±2 nt variations of the mature miRNA on the precursor.

dThe differentially expressed miRNAs were analyzed using general Chi-square tests.

Len means length of miRNAs. Adumix means miRNA of parasites of mixed adult.

Hao et al. BMC Genomics 2010 11:55   doi:10.1186/1471-2164-11-55

Open Data