Table 1

Common miRNAs identified in S. japonicum

MicroRNA Name

Mature Arm

miR*a

Most abundant sequence

Len

Expressionc (TPMb)

AduMix

schistosomulum

P-valued


Sja-mir-71

5'

Y

UGAAAGACUUGAGUAGUGAGACG

23

16813

32629

0.

Sja-mir-7

5'

Y

UGGAAGACUGGUGAUAUGUUGUU

23

4256

9969

0

Sja-let-7

5'

Y

GGAGGUAGUUCGUUGUGUGGU

21

2650

2840

0

Sja-mir-2b

3'

Y

UCACAGCCAGUAUUGAUGAACG

22

4004

1104

0

Sja-mir-124

3'

Y

UAAGGCACGCGGUGAAUGUCA

21

1542

386

0

Sja-mir-36a

3'

Y

CCACCGGGUAGACAUUCAUUCGC

23

715

641

0.0263

Sja-mir-10

5'

Y

AACCCUGUAGACCCGAGUUUGG

22

238

440

0

Sja-mir-219

5'

Y

UGAUUGUCCAUUCGCAUUUCUUG

23

494

103

0

Sja-mir-8

3'

N

UAAUACUGUUAGGUAAAGAUGCC

23

159

78

0

Sja-mir-2a

3'

Y

UAUCACAGCCCUGCUUGGGACACA

24

163

10

0

Sja-mir-36b

3'

Y

CCACCGGGUAGACAUUCAU

19

9

11

0.2002

Sja-mir-1810

5'

N

CUAAUAGGGAACGUGAGCU

19

8

6

0.3083

Sja-mir-281

3'

Y

UGUCAUGGAGUUGCUCUCUAU

21

10

1

0

Sja-mir-76

3'

Y

UUCGUUGUUGAUGAAACUGG

20

4

1

0

Sja-mir-307

3'

Y

UCACAACCUACUUGAUUGAGG

21

4

1

0.0001

Sja-mir-923

5'

N

AAGCGGAGGAAAAGAAAU

18

1

1

0.1216


aY indicates that the sequences from both strands of a miRNA* species were found, while N means that only the sequence from one strand of a miRNA* was identified.n

bThe abundance value of each miRNA was normalized to "transcripts per million (TPM)". If the value after normalization was less than 1, the normalized value was set as 1.

cThe expression of miRNA was the sum of the total counts of unique reads which was within ±2 nt variations of the mature miRNA on the precursor.

dThe differentially expressed miRNAs were analyzed using general Chi-square tests.

Len means length of miRNAs. Adumix means miRNA of parasites of mixed adult.

Hao et al. BMC Genomics 2010 11:55   doi:10.1186/1471-2164-11-55

Open Data