Table 3

List of primers used in this study

Gene

cDNA length (bp)

Genbank accession number

Forward primer

Reverse primer

Distance from 3' end (bp)


ANXA1

1399

NM_000700

GGAACGCTTTGCTTTCTCTTG

TTCTGGTGGTAAGGATGGTATTG

795

ACTB

1852

NM_001101

AGAAAATCTGGCACCACACC

GGGGTGTTGAAGGTCTCAAA

1520

ELANE

938

NM_001972

CGGGCTAATCCACGGAATTG

TTGTCCTCGGAGCGTTGG

273

GAPDH

1310

NM_002046

CAGCCTCAAGATCATCAGCA

TGTGGTCATGAGTCCTTCCA

782

HAMP

430

NM_021175

AGTGGCTCTGTTTTCC

GAAGTGGGTGTCTCG

292

HIF1A

4082

NM_001530

AGAAGGTATGTGGCATTTATTTGG

CAGGGTAGGCAGAACATTTAGG

516

CGTGTTATCTGTCGCTTTGAGTC

TTTCGCTTTCTCTGAGCATTCTG

1611

TTGGCAGCAACGACACAG

GCAGGGTCAGCACTACTTC

2440

AGCCGAGGAAGAACTATGAAC

ACTGAGGTTGGTTACTGTTGG

3149

CCTGACAAGCCACCTGAG

TCGTGAGACTAGAGAGAAGC

3892

LY96

619

NM_015364

TGCCGAGGATCTGATGAC

ATTAGGTTGGTGTAGGATGAC

245

MMP9

2387

NM_004994

AACTACGACACCGACGAC

CAGGCGGAGTAGGATTGG

1587

STAT3

4900

NM_003150

GCTGGCTGACTGGAAGAG

AGTTGAGATTCTGCTAATGACG

3943

TFRC

5241

NM_003234

ATTGAACCTGGACTATGAGAG

GGAAGTAGCACGGAAGAAG

3140

TNF-α-1

1669

NM_000594

AGTGACAAGCCTGTAGCC

GGACCTGGGAGTAGATGAG

1243

TNF-α-2

1669

NM_000594

AAACAATGCTGATTTGGTGAC

GGCGATTACAGACACAACTCC

119

VEGFB

1172

NM_003377

CTGTGGTGGCTGCTG

ACTGGCTGTGTTCTTCC

901


Primers were designed with the Beacon Designer software. All PCR products were sequenced to confirm specificity.

Jeanty et al. BMC Genomics 2010 11:542   doi:10.1186/1471-2164-11-542

Open Data