Table 1

Families and characteristics of silkworm MITEs

Family

TSD1

TIR

Size (bp)

AT content (%)

No.FC2

No.FLC3 (%)

-ΔG4

Known family


BmMITE-1

WW

TCGATGGCTCCAATGAACACTAC

234

68

216

44(17)

39

Novel

BmMITE-2

TA/AT

TGAGTCGACTATTATCAAAG

278

67

419

2371(85)

66

Hoshidandy5

BmMITE-3

TA

GATATGTGTCGTTCG

306

54

12

34(74)

47

Stowaway-like

BmMITE-4

TWA

GGGTCAATTCCCACTGAAAGAGCAGCGGC

567

44

9

7(44)

125

Tourist-like

BmMITE-5

TWA

AGCCTTGTTCGCACTAAGCGAGTATTTTA

GTCGAGTACCGAGTAATTTAGTGGCTAAA

213

61

53

81(60)

74

Tourist-like

BmMITE-6

TWA

GGGCCTGTGCACACCACGTTTTTTAA

270

52

11

8(42)

81

Tourist-like

BmMITE-7

TDA

TGCTGGAACCACACTGCG

548

55

7

13(65)

93

Organdy6

BmMITE-8

TA

TATATCGACGCTTGAAAGGCAAAC

266

67

1364

147(10)

47

Stowaway-like

BmMITE-9

ATT

GGTAGTTTTCCAATTACAG

418

63

75

88(54)

52

Novel

BmMITE-10

ATAT

CGTCGCTGTCAAACCAAAATCTGCTATGTGCAA

258

70

142

159(53)

38

Novel

BmMITE-11

ATATAT

GTGGGATT

238

67

1

15(94)

8

Novel

BmMITE-12

TTCATTT

TTACTTTGCA

210

73

20

121(86)

14

Novel

BmMITE-13

NNNNNNNN

CAAGGGCGGATCCAG

263

59

69

171(71)

32

Pegasus-like

BmMITE-14

NNNNNNNN

CAGTGGCGGATTA

431

59

12

22(65)

38

Pegasus-like

BmMITE-15

NNNNNNNN

CAGTGGCGTACCTA

300

65

0

9(100)

60

Pegasus-like

BmMITE-16

NNNNNNNN

CAGTGGCGGATTT

265

55

18

25(58)

43

Pegasus-like

BmMITE-17

TTACTGTAT

GCGCGCGAGTTCATGT

494

59

20

22(52)

53

Novel


1 N = A/T/C/G; W = A/T; D = A/T/G. 2 No. FC means the number of fragmentary copies. 3No.FLC indicates the number of full length copies, the number of the bracket is the ratios of full length copies in total of each MITE family. 4-ΔG means the average negative ΔG(kcal/mol) value of each MITE family. 5Hoshidandy was referred to the accession No. AB455941 in NCBI. 6Organdy was first discovered in silkworm by Komoto et al. [26]. MITE families were classified based on TIR, TSD and internal sequences.

Han et al. BMC Genomics 2010 11:520   doi:10.1186/1471-2164-11-520

Open Data