Table 2

Identification of novel silkworm-specific miRNAs based on sequencing miRNAs and miRNA_Stars in different developmental stages.

miRNA

Sequence of mature miRNA

Feeding larvae

Spinning larvae

Pupae

Moths

Remarks

miR

miR*

miR

miR*

miR

miR*

miR

miR*


bmo-mir-2998

AAGAACAGGAUGAGGUAGAUAAA

26

1

9

0

10

0

88

1

bmo-mir-375

ACCCGAGCGGUCUGAGCAAACU

30

6

4

2

25

11

11

3

bmo-mir-2766

UCAGUCUUGUCGAAUGGUGGGU

2205

284

2657

166

4588

341

2328

133

bmo-mir-2999

CUGCGACGGACUAGACGCGCA

20

2

3

0

16

0

107

0

bmo-mir-2763

AUAUUAUGCUCAUUUCUUUGGAU

15

0

49

0

39

1

199

0

bmo-mir-2733e-1

UCACUGGGAAUGUAAUAGCUAU

1

0

4

0

273

0

1

0

Family

bmo-mir-2733f

UCACUGGGUAUGUAAUGACAGU

1

0

0

0

83

0

1

0

Family

bmo-mir-2733 g

UCACUGGGUGCAUGAAGAUUG

2

0

0

0

629

2

1

0

Family

bmo-mir-2733a-2

UCACUGGGUGCAUGAUGAUUG

16

0

6

0

2718

2

93

0

Family

bmo-mir-2733b

UCACUGGGUGCGUGAUGAUUGU

0

0

0

0

134

3

0

0

Family

bmo-mir-2733d

UCACUGGGUGUAUGAAGAUUG

0

0

2

0

392

1

5

0

Family

bmo-mir-2733 h

UCACUGGGUGUAUGAUGAUUG

0

0

1

0

163

2

1

0

Family

bmo-mir-3000

CUGCGCUUAGAUGAAGACACUA

53

1

7

0

6

0

6

0

bmo-mir-3001

UAAGUUGAAAGAAUUGUAGAUUUUGA

4

7

7

8

12

2

14

14


Jagadeeswaran et al. BMC Genomics 2010 11:52   doi:10.1186/1471-2164-11-52

Open Data